G206856 (tbx22)


Basic Information

Item Value
gene id G206856
gene name tbx22
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035920.1
NCBI id CM008323.1
chromosome length 47266144
location 20418316 ~ 20418553 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU280685
TGTAGCCGTACAGTCCGTAAGGTGGTGCGAGAGAAGACGCCAGGCTGCTCGGTTGGGCCTGGTGAGCTCCGGAGGTGCGGCTGGATTGAAGGCTTTGGATGGAGAGCAGGCAGGGGCCGATGGCAGTCGGGCCCTGGAGGCACTGGCCCCGACAGCTGGCGGCTTTCTTTCCATGGAGAGGAGATAGCAGAGGGAAGTCTGTCAAAGGTCGCAACGCTGGGTAACCTCTGAGTCTGTC

Function

symbol description
tbx22 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in cell fate specification; heart looping; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Is expressed in mandibular arch skeleton; maxilla; paraxial mesoderm; and stomodeum. Human ortholog(s) of this gene implicated in Abruzzo-Erickson syndrome; X-linked cleft palate with or without ankyloglossia; and cleft palate. Orthologous to human TBX22 (T-box transcription factor 22).

NR:

description
PREDICTED: T-box transcription factor TBX22

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU280685 True 238 lncRNA 0.62 1 20418316 20418553

Neighbor

gene id symbol gene type direction distance location
itm2a itm2a coding downstream 36306 20372886 ~ 20382010 (-)
cysltr1 cysltr1,LOC107703837,LOC107576072,LOC107591877,LOC107688612 coding downstream 173827 20239867 ~ 20244489 (-)
LOC103043211 LOC103366304,LOC105906309,LOC108268916,LOC102229095,LOC100704732,LOC107386560,LOC101162152,LOC103395326,LOC105927798 coding downstream 229563 20180310 ~ 20188753 (-)
LOC103043510 ednr,LOC103043510,LOC108443108,LOC108268917,LOC104965768,LOC106930986,LOC103470946,LOC106530016,LOC108238010 coding downstream 277257 20123147 ~ 20141059 (-)
vamp7 vamp7 coding downstream 313476 20099499 ~ 20104840 (-)
LOC103041461 chmp1b,LOC101476317 coding upstream 14972 20433525 ~ 20441496 (-)
hdx hdx coding upstream 367461 20786014 ~ 20800527 (-)
tenm1 tenm1,LOC105906218 coding upstream 562202 20980755 ~ 21355637 (-)
LOC103037071 arhgef9,LOC108436700,LOC108269078 coding upstream 1112207 21530760 ~ 21599719 (-)
LOC103036462 LOC108436702,LOC105906303,LOC106604272 coding upstream 1194280 21612833 ~ 21617288 (-)
G206843 NA non-coding downstream 45845 20364914 ~ 20372471 (-)
G206784 NA non-coding downstream 331823 20086177 ~ 20086493 (-)
G206782 NA non-coding downstream 343626 20074425 ~ 20074690 (-)
G206763 NA non-coding downstream 566355 19814974 ~ 19851961 (-)
G206685 NA non-coding downstream 737106 19601599 ~ 19681210 (-)
G206859 NA non-coding upstream 115027 20533580 ~ 20537400 (-)
G206912 NA non-coding upstream 299396 20717949 ~ 20725371 (-)
G206991 NA non-coding upstream 782620 21201173 ~ 21208804 (-)
G206998 NA non-coding upstream 978161 21396714 ~ 21396928 (-)
G207000 NA non-coding upstream 985904 21404457 ~ 21404698 (-)
LOC103040644 LOC108443111 other downstream 143411 20107097 ~ 20274905 (-)
LOC103046671 NA other downstream 423514 19925031 ~ 19994802 (-)
LOC103046056 NA other downstream 450285 19957477 ~ 19968031 (-)
thoc2 thoc2,LOC107733416,LOC107741598 other downstream 1290590 19037694 ~ 19127726 (-)
G206575 NA other downstream 1579400 18838369 ~ 18838916 (-)
LOC103040850 hmgn5 other upstream 45150 20463703 ~ 20512287 (-)
LOC103039395 rps6ka6,rps6kal,LOC107572332,LOC107674878,LOC102207076 other upstream 258900 20677453 ~ 20782984 (-)
LOC103034681 LOC108436714 other upstream 1345551 21764104 ~ 22247113 (-)
LOC111195740 vma21,LOC108436707,LOC106604103 other upstream 1561246 21979799 ~ 21982730 (-)
LOC103035944 mical3 other upstream 2466879 22885432 ~ 22956024 (-)

Expression


Co-expression Network