G208026 (uba2,LOC107701803)


Basic Information

Item Value
gene id G208026
gene name uba2,LOC107701803
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035920.1
NCBI id CM008323.1
chromosome length 47266144
location 26121477 ~ 26122367 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU282360
TTAAAGAGGTATTTGGCCCATACAATGCAGTGGATGGGTTCAGACGGGGTATTGCGTATAGTGCAGCCAGGGAAGGTCTTCTGTGTGGGTTTAGGTTGGCACTCGTAGCACTCTGTCACTCCCTTCTTGATCACAGTGACCTGGCCGAGGTATCCTGCTGTACCACTCTCGATTAGAGGAATATCAGCAGCCAAACACATCCTGTTCACATGATTGCGGGCCGCTCTGTTATCCAGGGCATTCATGACCAGCTGGAAACTTCTGAAGAATTCCACATTG

Function

symbol description
uba2 Predicted to enable SUMO activating enzyme activity. Predicted to be involved in protein sumoylation. Predicted to be located in nucleus. Predicted to be part of SUMO activating enzyme complex. Predicted to be active in cytoplasm. Orthologous to human UBA2 (ubiquitin like modifier activating enzyme 2).

NR:

description
PREDICTED: SUMO-activating enzyme subunit 2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU282360 True 279 lncRNA 0.50 3 26121477 26122367

Neighbor

gene id symbol gene type direction distance location
LOC111195834 NA coding downstream 21650 26096805 ~ 26099827 (-)
LOC111195867 NA coding downstream 26286 26092170 ~ 26095191 (-)
LOC103040521 NA coding downstream 435866 25681230 ~ 25685611 (-)
znrf1 znrf1,LOC107589180,LOC107714072 coding downstream 549206 25496301 ~ 25572271 (-)
LOC103040081 snrkb,LOC108413384,LOC108268812,LOC107674965,LOC107589179,LOC107571964,LOC107714071 coding downstream 669386 25412186 ~ 25452091 (-)
LOC111195836 NA coding upstream 121881 26244248 ~ 26246421 (-)
LOC103031232 arntl1a,LOC108439331,LOC107707455,LOC107753525,LOC107665721,LOC108269000 coding upstream 491495 26613862 ~ 26640223 (-)
cep290 cep290 coding upstream 551239 26673606 ~ 26715253 (-)
kitlg NA coding upstream 670395 26792762 ~ 26815459 (-)
LOC111195856 NA coding upstream 823927 26946294 ~ 26949370 (-)
G208022 NA non-coding downstream 21654 26091811 ~ 26099823 (-)
G208015 sept15,LOC108428130,LOC107707522,LOC107701486,LOC107654154 non-coding downstream 44831 26061311 ~ 26076646 (-)
G208011 NA non-coding downstream 106474 26014747 ~ 26015003 (-)
G208008 NA non-coding downstream 107861 26007220 ~ 26013616 (-)
G207965 NA non-coding downstream 203917 25903907 ~ 25917560 (-)
G208027 uba2 non-coding upstream 980 26123347 ~ 26124768 (-)
G208030 NA non-coding upstream 4740 26127107 ~ 26157046 (-)
G208029 ca5a,LOC107583128,LOC108268921,LOC107701525,LOC107654151,LOC107581837 non-coding upstream 12219 26134586 ~ 26155268 (-)
G208042 NA non-coding upstream 41548 26163915 ~ 26169806 (-)
G208047 NA non-coding upstream 92532 26214899 ~ 26215110 (-)
LOC111195835 NA other downstream 3845 26103487 ~ 26117632 (-)
LOC111195761 NA other downstream 33062 26086651 ~ 26088415 (-)
LOC111195762 NA other downstream 34973 26079764 ~ 26086504 (-)
LOC111195825 NA other downstream 128983 25989438 ~ 25992494 (-)
LOC111195756 NA other downstream 183445 25919220 ~ 25938032 (-)
G208046 NA other upstream 89691 26212058 ~ 26212841 (-)
G208394 borcs5,LOC107753635 other upstream 533076 26655443 ~ 26656184 (-)
wwp2 wwp2,LOC108439047,LOC107740243,LOC107560080 other upstream 2094028 28216395 ~ 28268369 (-)
LOC107197304 NA other upstream 2539816 28662183 ~ 28695700 (-)
lrp5 lrp5,LOC107654131,LOC107714037,LOC107581849,LOC107701817,LOC106573620 other upstream 2660716 28783083 ~ 28860774 (-)

Expression


Co-expression Network