G50480


Basic Information

Item Value
gene id G50480
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 117563 ~ 118000 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU57439
AAGAATGCTAGCTTCTGGATTATGGCTGAAGCAAGACGCTCACAGGTATGCCAGGGATACGGCAACGCGACGCTATGTCATATGACGTTATGGGAACACTGTCCCAACTACGCCGTAGAACCAAGTACCTGTCTGTTATCTTGTAGACAGAACTGACGACCCCGGAGTGGAGCCTATATCCAGGTTATAAAACCTAATAAATGTGTGCTGGGATGACCATCCAGCTGAATCACATGTGTCATTAATGGATACTCCTGACATTAAGGCCTTTGAGGCCGCCATACCCCTAGTAGAGTAGACACGGACAGCTAATGGAGATGGCTGTCCGGCCGCCTCATAAGCAAGTGAGATAGCCTCGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU57439 True 360 lncRNA 0.49 2 117563 118000

Neighbor

gene id symbol gene type direction distance location
CI01000009_00094836_00095813 NA coding upstream 20814 94371 ~ 97230 (+)
CI01000009_00179808_00221387 UGGT2 coding downstream 61808 179808 ~ 221387 (+)
CI01000009_00242093_00247335 FDX1 coding downstream 123961 241961 ~ 247343 (+)
CI01000009_00260081_00285692 RNF17 coding downstream 141906 259906 ~ 285711 (+)
CI01000009_00300778_00315275 NA coding downstream 182778 300778 ~ 315405 (+)
CI01000009_00318494_00322434 NA coding downstream 200256 318256 ~ 323055 (+)
G50473 NA non-coding upstream 18507 97886 ~ 99056 (+)
G50469 NA non-coding upstream 38047 79280 ~ 79516 (+)
G50440 NA non-coding upstream 95965 21316 ~ 21598 (+)
G50508 NA non-coding downstream 58066 176066 ~ 222848 (+)
G50662 NA non-coding downstream 217039 335039 ~ 335961 (+)
G50664 NA non-coding downstream 240478 358478 ~ 358706 (+)
G50666 NA non-coding downstream 262548 380548 ~ 380857 (+)
G50627 NA non-coding downstream 263214 381214 ~ 385408 (+)
G50920 NA other downstream 651841 769841 ~ 770233 (+)
CI01000009_01431700_01434463 NA other downstream 1304847 1429873 ~ 1435328 (+)
G51122 NA other downstream 1562146 1680146 ~ 1681966 (+)
CI01000009_01897343_01919208 PIKFYVE other downstream 1776235 1897343 ~ 1919516 (+)
G51274 NA other downstream 2137099 2255099 ~ 2350486 (+)

Expression


Co-expression Network