G50633


Basic Information

Item Value
gene id G50633
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 388750 ~ 389122 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU57621
TAATGGCTGTGAATTGGGGGCCGCGTTTTGAATGGCGGAGGATTTTGATATAAGAGAAGAGGAGTTTAAATTTGTTGCACAGCCCTATTTTTTTGAACCATGAGAGGCATCTAAGCTTACAATACTCCTACATTCTGCGTCATACATCACATCAGAGGATTACTCATTTGGCGTAAGTCGACTTGCGCATTCTGCGTACTGTCGTCCACCGGAGGCTTATTATTTGAATTGATAAAGTTTTAAATATGGATATTTTTCTTACAAAAATGTACCGCTTCACTTCAAAAAGCCTTTTTTTTTAAACTATTTGAATTATATGGACTACTTTTTTATGGATGGATGAATTATTTTTTACTTCAAAACGAGGCCCCCC

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU57621 True 373 lncRNA 0.37 1 388750 389122

Neighbor

gene id symbol gene type direction distance location
CI01000009_00378726_00379550 NA coding upstream 8946 378726 ~ 379804 (+)
CI01000009_00363403_00368182 RNASEH2B coding upstream 20534 363403 ~ 368216 (+)
CI01000009_00343750_00344964 TRIM13 coding upstream 43460 343750 ~ 345290 (+)
CI01000009_00326208_00333904 NA coding upstream 54449 326208 ~ 334301 (+)
CI01000009_00318494_00322434 NA coding upstream 65695 318256 ~ 323055 (+)
CI01000009_00541592_00545933 CMSS1 coding downstream 151647 540769 ~ 545997 (+)
CI01000009_00547369_00551459 NA coding downstream 158247 547369 ~ 552216 (+)
CI01000009_00603498_00605392 NA coding downstream 214106 603228 ~ 605392 (+)
CI01000009_00605366_00605964 COL8A1, COL8A1A coding downstream 216244 605366 ~ 606070 (+)
CI01000009_00608513_00609159 JAGN1, JAGN1A, JGN1A coding downstream 219391 608513 ~ 609375 (+)
G50639 NA non-coding upstream 98 388198 ~ 388652 (+)
G50627 NA non-coding upstream 3342 381214 ~ 385408 (+)
G50666 NA non-coding upstream 7893 380548 ~ 380857 (+)
G50664 NA non-coding upstream 30044 358478 ~ 358706 (+)
G50662 NA non-coding upstream 52789 335039 ~ 335961 (+)
G50631 NA non-coding downstream 6253 395375 ~ 495961 (+)
G50719 NA non-coding downstream 115296 504418 ~ 504619 (+)
G50735 NA non-coding downstream 149049 538171 ~ 538511 (+)
G50855 NA non-coding downstream 201010 590132 ~ 590613 (+)
G50881 NA non-coding downstream 234612 623734 ~ 623957 (+)
CI01000009_00094836_00095813 NA other upstream 292963 94371 ~ 97230 (+)
G50920 NA other downstream 380719 769841 ~ 770233 (+)
CI01000009_01431700_01434463 NA other downstream 1033725 1429873 ~ 1435328 (+)
G51122 NA other downstream 1291024 1680146 ~ 1681966 (+)
CI01000009_01897343_01919208 PIKFYVE other downstream 1505113 1897343 ~ 1919516 (+)
G51274 NA other downstream 1865977 2255099 ~ 2350486 (+)

Expression


Co-expression Network