G50902


Basic Information

Item Value
gene id G50902
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 697605 ~ 697840 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU57924
CCACTATCTAGCAAGGAGTAGGGATGGATGACCAAAATCTTTAATCACAATATGAGTAATGTTCACAGTAACAATATATATAATGATATGGTCTATTTTTTCTGGAAAAAAAAGGTTGTCACAATACCAAAATTTTAGATACCAGTGAAATTCCACTATTCTCAATACCAGTTTTGATACTGAAGGGGTGGATTCTGGAATCCACTGCCGCTTCAATATATATCTTTTAAGTTATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU57924 True 236 lncRNA 0.33 1 697605 697840

Neighbor

gene id symbol gene type direction distance location
CI01000009_00620687_00621072 NA coding upstream 76068 620687 ~ 621537 (+)
CI01000009_00611583_00617762 TFG coding upstream 79843 611305 ~ 617762 (+)
CI01000009_00608513_00609159 JAGN1, JAGN1A, JGN1A coding upstream 88230 608513 ~ 609375 (+)
CI01000009_00605366_00605964 COL8A1, COL8A1A coding upstream 91535 605366 ~ 606070 (+)
CI01000009_00603498_00605392 NA coding upstream 92213 603228 ~ 605392 (+)
CI01000009_00704243_00710805 NA coding downstream 6225 704065 ~ 710805 (+)
CI01000009_00719164_00724772 SRPX coding downstream 21324 719164 ~ 725051 (+)
CI01000009_00805606_00808374 NA coding downstream 107064 804904 ~ 808404 (+)
CI01000009_00852319_00853083 CX45.6 coding downstream 153402 851242 ~ 853461 (+)
CI01000009_00913995_00916434 COMMD6 coding downstream 216155 913995 ~ 916565 (+)
G50878 NA non-coding upstream 2390 694026 ~ 695215 (+)
G50880 NA non-coding upstream 52556 644785 ~ 645049 (+)
G50883 NA non-coding upstream 60900 636474 ~ 636705 (+)
G50881 NA non-coding upstream 73648 623734 ~ 623957 (+)
G50855 NA non-coding upstream 106992 590132 ~ 590613 (+)
G50876 NA non-coding downstream 29233 727073 ~ 728482 (+)
G50879 NA non-coding downstream 31023 728863 ~ 729820 (+)
G50909 NA non-coding downstream 37887 735727 ~ 736025 (+)
G50911 NA non-coding downstream 44161 742001 ~ 745178 (+)
G50913 NA non-coding downstream 48354 746194 ~ 756171 (+)
CI01000009_00094836_00095813 NA other upstream 601818 94371 ~ 97230 (+)
G50920 NA other downstream 72001 769841 ~ 770233 (+)
CI01000009_01431700_01434463 NA other downstream 725007 1429873 ~ 1435328 (+)
G51122 NA other downstream 982306 1680146 ~ 1681966 (+)
CI01000009_01897343_01919208 PIKFYVE other downstream 1196395 1897343 ~ 1919516 (+)
G51274 NA other downstream 1557259 2255099 ~ 2350486 (+)

Expression


Co-expression Network