G51930



Basic Information


Item Value
gene id G51930
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 795914 ~ 796164 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU59167
ATATTTCTGTGCAAATCACCTCTGTCTGCCCGTACAGCTGAAAGCTTCATGTTTGTATATAGATATGACACCGTTTCATTGAATGCTCTGTATACTGTCTTTGGGGAAACATGAGAGATAAGTGTTGTGCAAGCTGATCAAATCCGAGGAACATTAAGGTTCACAGAAGCATTTGAAATTTGTATTGTGAATGTTCGTTGCGTCTGGAATCAGAGGCACCAAAAAAAAAGAAAGAAAAAAAATGTAATAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU59167 True 251 lncRNA 0.31 1 795914 796164

Neighbor


gene id symbol gene type direction distance location
CI01000009_00761898_00767155 PIGA coding downstream 27636 761718 ~ 768278 (-)
CI01000009_00757227_00760184 ASB11 coding downstream 35730 757102 ~ 760184 (-)
CI01000009_00729688_00746565 SYTL5 coding downstream 48442 729369 ~ 747472 (-)
CI01000009_00698847_00703072 NA coding downstream 92842 698546 ~ 703072 (-)
CI01000009_00694683_00695141 MID1IP1A, MID1IP1 coding downstream 100698 693973 ~ 695216 (-)
CI01000009_00812290_00814461 CX50.5 coding upstream 15202 811366 ~ 814575 (-)
CI01000009_00830503_00840457 NA coding upstream 33517 829681 ~ 840961 (-)
CI01000009_00863406_00870786 NA coding upstream 67113 863277 ~ 872274 (-)
CI01000009_00884784_00892234 CHAF1B coding upstream 88417 884581 ~ 892234 (-)
CI01000009_00895893_00912998 MORC3A coding upstream 99263 895427 ~ 912998 (-)
G51928 NA non-coding downstream 2483 793096 ~ 793431 (-)
G51901 NA non-coding downstream 12185 779045 ~ 783729 (-)
G51923 NA non-coding downstream 19394 776284 ~ 776520 (-)
G51922 NA non-coding downstream 21587 774036 ~ 774327 (-)
G51920 NA non-coding downstream 23445 772120 ~ 772469 (-)
G51931 NA non-coding upstream 213 796377 ~ 796616 (-)
G51932 NA non-coding upstream 1074 797238 ~ 797442 (-)
G51933 NA non-coding upstream 7592 803756 ~ 804023 (-)
G51909 NA non-coding upstream 19857 816021 ~ 816397 (-)
G51982 NA non-coding upstream 169725 965889 ~ 966472 (-)
G52098 NA other upstream 605768 1401932 ~ 1407627 (-)
G52410 NA other upstream 1755560 2551724 ~ 2562533 (-)
CI01000009_02885473_02893975 NA other upstream 2087524 2883688 ~ 2893975 (-)
CI01000009_03261739_03262843 NA other upstream 2465039 3261038 ~ 3262843 (-)

Expression



Co-expression Network