G51909



Basic Information


Item Value
gene id G51909
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 816021 ~ 816397 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU59146
CAACGTGGATTGTGTGCCTTTCCTCTCTTCCTCCAGACTCTGGGACCCTGATTTCCAAAGGAAATGCAAAATTTACTTTCATCAGAGAACATAACTTTGGACCACTCAGCAGCAGTCCATTCCTTTTTGTCTTTAGCCCAGGCGTGACGCTTCTGACGCTGTCTGTTGTTCAAGAGTGGCTTGACACAAGGAATGCGACAGCTGAATCCCATGTCTTACATACGTCTGTGCGTAGTGGTTCTTGAAGCACTGACTCCAGCTGCAGTCCACTCTTTGTGAATCTCCCCCACATTTTTGAATGGGTTTTGTTTCACAATCCTCTCCAGGGTGCGGTTATCCCTATTGCTTGTACATTTTTTTCTACCACATCTTTTCCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU59146 True 377 lncRNA 0.46 1 816021 816397

Neighbor


gene id symbol gene type direction distance location
CI01000009_00812290_00814461 CX50.5 coding downstream 1446 811366 ~ 814575 (-)
CI01000009_00761898_00767155 PIGA coding downstream 47743 761718 ~ 768278 (-)
CI01000009_00757227_00760184 ASB11 coding downstream 55837 757102 ~ 760184 (-)
CI01000009_00729688_00746565 SYTL5 coding downstream 68549 729369 ~ 747472 (-)
CI01000009_00698847_00703072 NA coding downstream 112949 698546 ~ 703072 (-)
CI01000009_00830503_00840457 NA coding upstream 13284 829681 ~ 840961 (-)
CI01000009_00863406_00870786 NA coding upstream 46880 863277 ~ 872274 (-)
CI01000009_00884784_00892234 CHAF1B coding upstream 68184 884581 ~ 892234 (-)
CI01000009_00895893_00912998 MORC3A coding upstream 79030 895427 ~ 912998 (-)
CI01000009_00973935_00975204 NA coding upstream 156906 973303 ~ 977133 (-)
G51933 NA non-coding downstream 11998 803756 ~ 804023 (-)
G51932 NA non-coding downstream 18579 797238 ~ 797442 (-)
G51931 NA non-coding downstream 19405 796377 ~ 796616 (-)
G51930 NA non-coding downstream 19857 795914 ~ 796164 (-)
G51928 NA non-coding downstream 22590 793096 ~ 793431 (-)
G51982 NA non-coding upstream 149492 965889 ~ 966472 (-)
G51991 NA non-coding upstream 162537 978934 ~ 979169 (-)
G51949 NA non-coding upstream 196433 1012830 ~ 1055425 (-)
G52009 NA non-coding upstream 266922 1083319 ~ 1083582 (-)
G51960 NA non-coding upstream 278151 1094548 ~ 1095267 (-)
G52098 NA other upstream 585535 1401932 ~ 1407627 (-)
G52410 NA other upstream 1735327 2551724 ~ 2562533 (-)
CI01000009_02885473_02893975 NA other upstream 2067291 2883688 ~ 2893975 (-)
CI01000009_03261739_03262843 NA other upstream 2444806 3261038 ~ 3262843 (-)

Expression



Co-expression Network