G34394


Basic Information

Item Value
gene id G34394
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 4775021 ~ 4775341 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU46273
tttgtccacaagtcgcggacgagagacatctgttattttagccgtcgccattctacactcgctgctgctctgctggcttgcgcgtgaatcgattaatttgttcagaacactaagtttatctgaatcctgccacaccgactgctgcggtgtgaatcagttttcttatgaactgaatcaaatcgcgcctactaatttgactcatttgaagctagtgactgggctatatacagtatcgaaagcattgaacgctaaagaaccgaatcgtttgtgatgacgtagtatcgaaaaagaatcgaaccttcggtacaccgtgcaactcta

Function

GO:

id name namespace
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU46273 True 321 lncRNA 0.42 1 4775021 4775341

Neighbor

gene id symbol gene type direction distance location
LOC103022011 gfra1,gfra1b,LOC107755550,LOC107702444,LOC107581544,LOC107707958 coding upstream 204172 4526945 ~ 4570849 (+)
bms1 bms1,LOC107689949,LOC107675025,LOC107566656 coding upstream 642050 4108457 ~ 4132971 (+)
LOC103043774 NA coding upstream 669268 4103372 ~ 4105753 (+)
LOC103037237 adgra1a,LOC108426471,LOC107754080,LOC107675035,LOC107565950,LOC107693584,LOC107563791 coding upstream 704289 4039157 ~ 4070732 (+)
LOC103037557 gabrz,LOC108426470,LOC108273489,LOC107675029,LOC107754081,LOC107565977,LOC107677887,LOC107563789,LOC107743757 coding upstream 771756 3958779 ~ 4003265 (+)
LOC103024286 timp2,timp2a,LOC103024286,LOC108274067,LOC107755484,LOC107684079,LOC107565802 coding downstream 23762 4799103 ~ 4819304 (+)
LOC103024595 arl3,LOC102778022,LOC103367836,LOC107684078,LOC103145158,LOC102201386 coding downstream 53697 4829038 ~ 4832548 (+)
twnk cunh10orf2,peo1,LOC107755431,LOC107690904,LOC107565785 coding downstream 156074 4931415 ~ 4937026 (+)
galk1 galk1 coding downstream 163658 4938999 ~ 4943449 (+)
llgl2 llgl2,LOC107690902,LOC107684069,LOC107755492,LOC107722216 coding downstream 168529 4943870 ~ 4966430 (+)
G34393 NA non-coding upstream 169 4773886 ~ 4774852 (+)
LOC111192352 NA non-coding upstream 66048 4704913 ~ 4708973 (+)
G34345 NA non-coding upstream 191044 4583718 ~ 4583977 (+)
G34288 NA non-coding upstream 636868 4137755 ~ 4138153 (+)
LOC111192351 NA non-coding upstream 766608 4003483 ~ 4008413 (+)
G34396 sfxn2 non-coding downstream 49002 4824343 ~ 4827906 (+)
G34410 mfsd13a non-coding downstream 95023 4870364 ~ 4871420 (+)
G34409 mfsd13a,LOC107755491,LOC107565800,LOC107690908 non-coding downstream 99797 4875138 ~ 4875554 (+)
G34485 NA non-coding downstream 196444 4971785 ~ 4973087 (+)
G34489 NA non-coding downstream 203406 4978747 ~ 4979412 (+)
G34309 NA other upstream 596938 4171051 ~ 4178083 (+)
tbkbp1 tbkbp1,LOC107565677,LOC107754096,LOC107677885,LOC107743771 other upstream 1115889 3564030 ~ 3659132 (+)
amz2 amz2 other upstream 2718058 2050742 ~ 2056963 (+)
LOC111192342 dnah9 other upstream 3387002 1369173 ~ 1388019 (+)
trnal-aag NA other upstream 3782503 992312 ~ 992518 (+)
LOC103025551 sema4g other downstream 107215 4882556 ~ 4924766 (+)
dnmbp dnmbp,LOC107722208,LOC107684043 other downstream 917181 5692522 ~ 5756116 (+)
LOC103045604 LOC108426437,LOC107683136 other downstream 1471305 6246646 ~ 6258050 (+)
slc38a10 slc38a10,LOC102792191,LOC107749860 other downstream 1726804 6502145 ~ 6541460 (+)
LOC103029551 qki2,LOC103029551,LOC108426533,LOC107684089,LOC108274051,LOC107749853,LOC107755469 other downstream 1817266 6592607 ~ 6663607 (+)

Expression


Co-expression Network