G34409 (mfsd13a,LOC107755491,LOC107565800,LOC107690908)


Basic Information

Item Value
gene id G34409
gene name mfsd13a,LOC107755491,LOC107565800,LOC107690908
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 4875138 ~ 4875554 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU46289
GAAGGAGCGGTCACTTAGCCAACCAAACAGGGGGTCATTCAGGCTATTCCATATCAGAAACACAGTCTCACCAACCCAGAAGGAGACTTTGTCGATCTTGTACACAGACACAAAAGTGTCCACATAATAAAGCAAAAAGACATTATGAAGGATGGAGACAAACAGGGACAGGGAGCCATACAGCACAGCTGTGGAGACACCCAGGTAAAAACTCCACACTCTCTTTCCCATCCTTCTCACGTTCTCTCACTTTCCTTCGGCTTTTCCTCCACCAGCAGGGCTTCATTCAGTCCATAAGCCAAGTACGGTCTGGTCATCATCCTACAAACG

Function

symbol description
mfsd13a Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human MFSD13A (major facilitator superfamily domain containing 13A).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU46289 True 330 lncRNA 0.50 2 4875138 4875554

Neighbor

gene id symbol gene type direction distance location
LOC103024595 arl3,LOC102778022,LOC103367836,LOC107684078,LOC103145158,LOC102201386 coding upstream 42590 4829038 ~ 4832548 (+)
LOC103024286 timp2,timp2a,LOC103024286,LOC108274067,LOC107755484,LOC107684079,LOC107565802 coding upstream 55834 4799103 ~ 4819304 (+)
LOC103022011 gfra1,gfra1b,LOC107755550,LOC107702444,LOC107581544,LOC107707958 coding upstream 304289 4526945 ~ 4570849 (+)
bms1 bms1,LOC107689949,LOC107675025,LOC107566656 coding upstream 742167 4108457 ~ 4132971 (+)
LOC103043774 NA coding upstream 769385 4103372 ~ 4105753 (+)
twnk cunh10orf2,peo1,LOC107755431,LOC107690904,LOC107565785 coding downstream 55861 4931415 ~ 4937026 (+)
galk1 galk1 coding downstream 63445 4938999 ~ 4943449 (+)
llgl2 llgl2,LOC107690902,LOC107684069,LOC107755492,LOC107722216 coding downstream 68316 4943870 ~ 4966430 (+)
chac2 chac2,LOC107749368,LOC107686371 coding downstream 92020 4967574 ~ 4971335 (+)
thbs2 thbs2b,LOC108426506,LOC108274281,LOC107755534,LOC107702453,LOC107566173,LOC107581559,LOC107707836 coding downstream 155253 5030807 ~ 5053505 (+)
G34410 mfsd13a non-coding upstream 3718 4870364 ~ 4871420 (+)
G34396 sfxn2 non-coding upstream 47232 4824343 ~ 4827906 (+)
G34394 NA non-coding upstream 99797 4775021 ~ 4775341 (+)
G34393 NA non-coding upstream 100286 4773886 ~ 4774852 (+)
LOC111192352 NA non-coding upstream 166165 4704913 ~ 4708973 (+)
G34485 NA non-coding downstream 96231 4971785 ~ 4973087 (+)
G34489 NA non-coding downstream 103193 4978747 ~ 4979412 (+)
G34500 NA non-coding downstream 178809 5054363 ~ 5056352 (+)
G34532 NA non-coding downstream 232256 5107810 ~ 5125290 (+)
G34534 NA non-coding downstream 259845 5135399 ~ 5135654 (+)
G34309 NA other upstream 697055 4171051 ~ 4178083 (+)
tbkbp1 tbkbp1,LOC107565677,LOC107754096,LOC107677885,LOC107743771 other upstream 1216006 3564030 ~ 3659132 (+)
amz2 amz2 other upstream 2818175 2050742 ~ 2056963 (+)
LOC111192342 dnah9 other upstream 3487119 1369173 ~ 1388019 (+)
trnal-aag NA other upstream 3882620 992312 ~ 992518 (+)
LOC103025551 sema4g other downstream 7002 4882556 ~ 4924766 (+)
dnmbp dnmbp,LOC107722208,LOC107684043 other downstream 816968 5692522 ~ 5756116 (+)
LOC103045604 LOC108426437,LOC107683136 other downstream 1371092 6246646 ~ 6258050 (+)
slc38a10 slc38a10,LOC102792191,LOC107749860 other downstream 1626591 6502145 ~ 6541460 (+)
LOC103029551 qki2,LOC103029551,LOC108426533,LOC107684089,LOC108274051,LOC107749853,LOC107755469 other downstream 1717053 6592607 ~ 6663607 (+)

Expression


Co-expression Network