G34544 (aldh18a1,LOC107684039)


Basic Information

Item Value
gene id G34544
gene name aldh18a1,LOC107684039
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 5150310 ~ 5150963 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU46460
ATCTTTAAGCTGATTCTGTCCGGAGTGAAGAGCTTGTCTGACACTCTGAGAGAGGAGAATTTCATGCCGCAGCCTCTGCTTCCCAAATGCCACAGCTCCACTTGTGACAATCATCATTTCTCTTCCCTGATTCTGTAGCATTGCCACCTGTTCAACAATGGAGGCAAGCCTGCCAAGAGCAAGGCCACACTCATCACCTCGAGTTACCACAGCACTGCCCAGCTTCACCACAATCCTTTTGGCTTGGCGCAGCTCGCTGCGGTGGGCGAACGACTTACCATGGGCACGAGCCAGAGGCACTGTAAGAAAAGGCACGTTACTCCATTGACGCACAGGATGGAGTCTGAAATATGGAGAGGTAGAGGGATCTGGAGGGAGAAAGAGCCAGGACATGAGCCAGTGAGGAGCCATGCCATGCAGTGAGCCAGTGAAGATGAGGAAAGAAAGGAGTGATGGGTGTGCAGACAAATAGCATCGCAGACATATGGTTAGG

Function

symbol description
aldh18a1 Predicted to enable glutamate-5-semialdehyde dehydrogenase activity. Predicted to be involved in L-proline biosynthetic process. Predicted to act upstream of or within phosphorylation and proline biosynthetic process. Predicted to be located in cytoplasm. Predicted to be active in mitochondrion. Is expressed in several structures, including central nervous system; endocrine system; eye; immature eye; and tail bud. Human ortholog(s) of this gene implicated in cataract; cutis laxa (multiple); enterocele; and hereditary spastic paraplegia (multiple). Orthologous to human ALDH18A1 (aldehyde dehydrogenase 18 family member A1).

NR:

description
PREDICTED: delta-1-pyrroline-5-carboxylate synthase-like isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU46460 True 493 lncRNA 0.50 2 5150310 5150963

Neighbor

gene id symbol gene type direction distance location
entpd1 NA coding downstream 25112 5099968 ~ 5125198 (-)
mrpl43 mrpl43,LOC107722220,LOC107581592,LOC107565786 coding downstream 219603 4927516 ~ 4930707 (-)
mfsd13a mfsd13a,LOC107565800,LOC107581593,LOC107684076,LOC107690908,LOC107755491 coding downstream 271551 4870049 ~ 4878759 (-)
LOC103024913 trim8,trim8b,LOC107581594,LOC107684075,LOC107565801,LOC107755490 coding downstream 282181 4853007 ~ 4868129 (-)
sfxn2 sfxn2,LOC107722238,LOC107581595,LOC107755483 coding downstream 302902 4819922 ~ 4847408 (-)
LOC103029658 crygmx,LOC103029658,LOC108426431,LOC107684144,LOC107566847,LOC107755411,LOC107581668 coding upstream 9945 5160908 ~ 5163466 (-)
LOC103030716 crygmxl2,LOC103030716,LOC108426411,LOC106516994,LOC104933141,LOC103368160,LOC107581669,LOC107702435 coding upstream 12987 5163950 ~ 5165625 (-)
vti1a vti1a,LOC107566351,LOC107702459 coding upstream 249965 5400928 ~ 5571634 (-)
acsl5 acsl5,LOC107702457,LOC107755526,LOC107566323,LOC107581566,LOC107722228,LOC107684041 coding upstream 428367 5579330 ~ 5596438 (-)
tectb tectb,LOC107755437,LOC107566341,LOC107702437,LOC107722201 coding upstream 449405 5600368 ~ 5687159 (-)
G34542 NA non-coding downstream 6254 5143724 ~ 5144056 (-)
G34541 NA non-coding downstream 6975 5143072 ~ 5143335 (-)
G34526 NA non-coding downstream 71462 5078535 ~ 5078848 (-)
G34505 chac2,LOC107749368,LOC107686371 non-coding downstream 179216 4967601 ~ 4971094 (-)
G34477 llgl2,LOC107684069 non-coding downstream 189387 4959388 ~ 4960923 (-)
G34543 aldh18a1,LOC107707764 non-coding upstream 409 5151372 ~ 5152413 (-)
G34556 NA non-coding upstream 40070 5191033 ~ 5193859 (-)
G34682 NA non-coding upstream 240132 5391095 ~ 5391320 (-)
G34688 zdhhc6,LOC107684040,LOC107722226,LOC107581631 non-coding upstream 422510 5573473 ~ 5574758 (-)
G34708 NA non-coding upstream 493943 5644906 ~ 5645105 (-)
psme4 psme4,psme4b,LOC108426507,LOC107584369,LOC107749369 other downstream 154397 4971698 ~ 4995913 (-)
G34214 NA other downstream 1266841 3836621 ~ 3883469 (-)
prr15l prr15l other downstream 1361118 3783125 ~ 3789192 (-)
G34046 NA other downstream 1955933 3181168 ~ 3194377 (-)
G33904 NA other downstream 2840981 2303262 ~ 2309329 (-)
tcf7l2 tcf7l2,LOC107755529,LOC107566231,LOC106949585 other upstream 104656 5255619 ~ 5362486 (-)
ccdc186 ccdc186,LOC107755417,LOC107689962 other upstream 752625 5903588 ~ 5928154 (-)
G34770 NA other upstream 784872 5935835 ~ 5939400 (-)
ablim1 ablim1 other upstream 898038 6049001 ~ 6147311 (-)
LOC103026268 bahcc1 other upstream 1215721 6366684 ~ 6513701 (-)

Expression


Co-expression Network