G37597 (scn4a)


Basic Information

Item Value
gene id G37597
gene name scn4a
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 18548083 ~ 18550231 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU50690
CTACGGTTTTGCTCCAGGCAGGAGGATTGCTCATGGTCATGAACACACAGTTGGACAGAATGGTAATCATGATGAACATGCTAAATAACGAATGTATGAGAATTTTAATGGCTCCTCTTCTGACGAGGTTAAAGGGGCTGAGAATGTAGCAGGCCGGTTCTGCGTTGAACCTGAAGATTGTGTTTCCTTTGCTAATTACAATAAATGT

Function

symbol description
scn4a Enables voltage-gated sodium channel activity. Involved in regulation of skeletal muscle contraction by action potential and sodium ion transmembrane transport. Is integral component of plasma membrane. Part of voltage-gated sodium channel complex. Implicated in congenital myasthenic syndrome 16; hyperkalemic periodic paralysis; and paramyotonia congenita of Von Eulenburg.

NR:

description
PREDICTED: sodium channel protein type 4 subunit alpha

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU50690 True 208 lncRNA 0.42 2 18548083 18550231

Neighbor

gene id symbol gene type direction distance location
LOC103034677 NA coding downstream 35998 18503640 ~ 18512085 (-)
LOC103047794 mapt,LOC108274153,LOC108441162 coding downstream 49727 18452946 ~ 18498356 (-)
LOC111192385 NA coding downstream 70962 18474987 ~ 18477121 (-)
LOC103033508 si:ch211-255p10.4,brsk1,LOC108441159,LOC107598587,LOC108247084,LOC103033508,LOC107557374,LOC108274928,LOC107654020,LOC107658484 coding downstream 138165 18388678 ~ 18409918 (-)
LOC103033182 LOC108441158,LOC108273897,LOC107664611,LOC107708947 coding downstream 163678 18360572 ~ 18384405 (-)
LOC107197613 LOC108429207,LOC108429768 coding upstream 512626 19062857 ~ 19124736 (-)
LOC103043551 LOC108444285,LOC108273949 coding upstream 729755 19279986 ~ 19291010 (-)
LOC111192386 rac3b,rac3,LOC100712409,LOC107571767,LOC108444292,LOC106535622,LOC106610298 coding upstream 780436 19330667 ~ 19340948 (-)
lrrc45 lrrc45 coding upstream 791798 19342029 ~ 19353789 (-)
LOC103038385 prkar1ab,LOC103038385,LOC108444289,LOC107693667,LOC107708993,LOC107602422,LOC108274040 coding upstream 872669 19422900 ~ 19436284 (-)
G37596 LOC108435052 non-coding downstream 175 18547625 ~ 18547908 (-)
LOC103035005 NA non-coding downstream 13312 18532616 ~ 18534771 (-)
G37565 NA non-coding downstream 98886 18410521 ~ 18449197 (-)
LOC103033820 NA non-coding downstream 129789 18411347 ~ 18418294 (-)
G37459 NA non-coding downstream 358639 18188473 ~ 18189444 (-)
G37598 scn4a,LOC108435052 non-coding upstream 4118 18554349 ~ 18554604 (-)
G37600 scn4aa,scn4a,LOC107598592,LOC107732174 non-coding upstream 12880 18563111 ~ 18563493 (-)
G37601 NA non-coding upstream 14510 18564741 ~ 18565071 (-)
G37602 LOC108244585,LOC108235708,LOC107390838 non-coding upstream 15433 18565664 ~ 18566018 (-)
G37604 scn4aa,LOC105894041,LOC107654028,LOC107732174,LOC107598592,LOC108435052 non-coding upstream 28203 18578434 ~ 18578712 (-)
LOC103047479 LOC108441156 other downstream 230126 18282490 ~ 18317957 (-)
vps25 vps25 other downstream 752095 17789951 ~ 17795988 (-)
cntd1 NA other downstream 843060 17692497 ~ 17705023 (-)
LOC103025753 LOC108425979,LOC108274047 other downstream 858699 17534703 ~ 17689384 (-)
LOC103025140 NA other downstream 1071205 17473910 ~ 17476878 (-)
G37603 NA other upstream 22460 18572691 ~ 18573176 (-)
G37616 NA other upstream 83347 18633578 ~ 18635098 (-)
LOC103045068 antxrl,antxr1c,LOC108437311,LOC105893913,LOC106589351,LOC107720085 other upstream 993994 19544225 ~ 19601284 (-)
c4h10orf128 NA other upstream 1268037 19818268 ~ 19825652 (-)
slc39a11 slc39a11,s39ab,LOC107653972,LOC107693650 other upstream 1961440 20511671 ~ 20679431 (-)

Expression


Co-expression Network