G37604 (scn4aa,LOC105894041,LOC107654028,LOC107732174,LOC107598592,LOC108435052)


Basic Information

Item Value
gene id G37604
gene name scn4aa,LOC105894041,LOC107654028,LOC107732174,LOC107598592,LOC108435052
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 18578434 ~ 18578712 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU50697
CACTTGCAGCAGCGAGAGGTAGCCCAGCCCCACATTGTCGTAGTTGACCTTGACGTTGACCCACCGCGCCTCGTTGGTGTACATTAACGCCATGCAGTCGCTTTTGTTGTTGACGAGATCCATTGGGAAAAGTTCTTCTGTGGTGGTGTTAATGCAGCGGTAGAACTTTCCAGCGAAGAGGTTGACCCCCATGATGCTGAAGATGAGCCAGAAGATCAGACACACCAGCAGCACGTTCATGATGGAAGGAATGGCGCCCACTAAAGCGTTCACTACCAC

Function

symbol description
scn4aa Predicted to enable voltage-gated sodium channel activity. Predicted to be involved in membrane depolarization during action potential; neuronal action potential; and sodium ion transmembrane transport. Predicted to act upstream of or within regulation of ion transmembrane transport; sodium ion transport; and transmembrane transport. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be part of voltage-gated sodium channel complex. Predicted to be active in axon. Is expressed in heart; musculature system; nervous system; pectoral fin; and testis. Human ortholog(s) of this gene implicated in congenital myasthenic syndrome 16; hyperkalemic periodic paralysis; and paramyotonia congenita of Von Eulenburg. Orthologous to human SCN4A (sodium voltage-gated channel alpha subunit 4).

NR:

description
PREDICTED: sodium channel protein type 4 subunit alpha A-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU50697 True 279 lncRNA 0.52 1 18578434 18578712

Neighbor

gene id symbol gene type direction distance location
LOC103034677 NA coding downstream 66349 18503640 ~ 18512085 (-)
LOC103047794 mapt,LOC108274153,LOC108441162 coding downstream 80078 18452946 ~ 18498356 (-)
LOC111192385 NA coding downstream 101313 18474987 ~ 18477121 (-)
LOC103033508 si:ch211-255p10.4,brsk1,LOC108441159,LOC107598587,LOC108247084,LOC103033508,LOC107557374,LOC108274928,LOC107654020,LOC107658484 coding downstream 168516 18388678 ~ 18409918 (-)
LOC103033182 LOC108441158,LOC108273897,LOC107664611,LOC107708947 coding downstream 194029 18360572 ~ 18384405 (-)
LOC107197613 LOC108429207,LOC108429768 coding upstream 484145 19062857 ~ 19124736 (-)
LOC103043551 LOC108444285,LOC108273949 coding upstream 701274 19279986 ~ 19291010 (-)
LOC111192386 rac3b,rac3,LOC100712409,LOC107571767,LOC108444292,LOC106535622,LOC106610298 coding upstream 751955 19330667 ~ 19340948 (-)
lrrc45 lrrc45 coding upstream 763317 19342029 ~ 19353789 (-)
LOC103038385 prkar1ab,LOC103038385,LOC108444289,LOC107693667,LOC107708993,LOC107602422,LOC108274040 coding upstream 844188 19422900 ~ 19436284 (-)
G37602 LOC108244585,LOC108235708,LOC107390838 non-coding downstream 12416 18565664 ~ 18566018 (-)
G37601 NA non-coding downstream 13363 18564741 ~ 18565071 (-)
G37600 scn4aa,scn4a,LOC107598592,LOC107732174 non-coding downstream 14941 18563111 ~ 18563493 (-)
G37598 scn4a,LOC108435052 non-coding downstream 23830 18554349 ~ 18554604 (-)
G37597 scn4a non-coding downstream 28203 18548083 ~ 18550231 (-)
G37605 scn4a,LOC107664628,LOC107708946,LOC107654028,LOC107732174,LOC108435052 non-coding upstream 2173 18580885 ~ 18581316 (-)
G37606 scn4a,LOC108435052,LOC107654028 non-coding upstream 2714 18581426 ~ 18587478 (-)
G37609 NA non-coding upstream 19545 18598257 ~ 18605649 (-)
G37612 plekhm1 non-coding upstream 36510 18615222 ~ 18620375 (-)
G37645 NA non-coding upstream 130741 18709453 ~ 18774343 (-)
G37603 NA other downstream 5258 18572691 ~ 18573176 (-)
LOC103047479 LOC108441156 other downstream 260477 18282490 ~ 18317957 (-)
vps25 vps25 other downstream 782446 17789951 ~ 17795988 (-)
cntd1 NA other downstream 873411 17692497 ~ 17705023 (-)
LOC103025753 LOC108425979,LOC108274047 other downstream 889050 17534703 ~ 17689384 (-)
G37616 NA other upstream 54866 18633578 ~ 18635098 (-)
LOC103045068 antxrl,antxr1c,LOC108437311,LOC105893913,LOC106589351,LOC107720085 other upstream 965513 19544225 ~ 19601284 (-)
c4h10orf128 NA other upstream 1239556 19818268 ~ 19825652 (-)
slc39a11 slc39a11,s39ab,LOC107653972,LOC107693650 other upstream 1932959 20511671 ~ 20679431 (-)
G38338 g6pc,g6pca.2,LOC107682718 other upstream 3294608 21873320 ~ 21878377 (-)

Expression


Co-expression Network