G38440


Basic Information

Item Value
gene id G38440
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 22429401 ~ 22430016 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU51849
gatcaggagaatctctcactatctttaataaactcctgaagactgagctcttcaaagagctcttactctcctaacacctctaactaactaccttctactaccagatcaggagaatctctcgctatctttaataaactcctgaagacagagctcttcaaagagcacttactctcctaacacctctaactaactaactacttctaa

Function

GO: NA

KEGG:

id description
ko04060 Cytokine-cytokine receptor interaction
ko04612 Antigen processing and presentation
ko05340 Primary immunodeficiency

RNA

RNA id representative length rna type GC content exon number start site end site
TU51849 True 204 lncRNA 0.39 2 22429401 22430016

Neighbor

gene id symbol gene type direction distance location
dkk1 dkk1 coding upstream 57914 22368776 ~ 22371487 (+)
prkg1 prkg1,prkg1b,LOC107695529,LOC106589397 coding upstream 79319 22097751 ~ 22350082 (+)
LOC111192422 NA coding upstream 331503 22070247 ~ 22097898 (+)
LOC103021762 asah2,LOC107598643 coding upstream 417596 21987804 ~ 22011805 (+)
LOC103023313 NA coding upstream 445117 21959447 ~ 21984284 (+)
LOC111192392 LOC108416223 coding downstream 568663 22998679 ~ 23000623 (+)
tfam NA coding downstream 957964 23387980 ~ 23396378 (+)
bicc1 bicc1,LOC107653928,LOC107695510 coding downstream 988837 23418853 ~ 23594042 (+)
phyhipl phyhipl,phyhiplb,LOC107727060,LOC107746456,LOC107654056,LOC107695536 coding downstream 1198671 23628687 ~ 23685558 (+)
LOC111192424 NA coding downstream 1971102 24401118 ~ 24402659 (+)
G38439 NA non-coding upstream 10232 22418888 ~ 22419169 (+)
G38438 NA non-coding upstream 18750 22410391 ~ 22410651 (+)
G38379 NA non-coding upstream 74787 22353509 ~ 22354614 (+)
G38392 NA non-coding upstream 102328 22278954 ~ 22327073 (+)
G38391 NA non-coding upstream 176759 22252149 ~ 22252642 (+)
G38460 NA non-coding downstream 184747 22614763 ~ 22617893 (+)
G38461 NA non-coding downstream 185531 22615547 ~ 22616453 (+)
G38469 NA non-coding downstream 313233 22743249 ~ 22743787 (+)
G38521 NA non-coding downstream 536895 22966911 ~ 22967205 (+)
G38523 NA non-coding downstream 538075 22968091 ~ 22968369 (+)
plce1 plce1,LOC107743958 other upstream 1132578 21166568 ~ 21296823 (+)
lgi1 lgi1,lgi1b,LOC107743957,LOC107664615,LOC107598600,LOC107654035,LOC107708938 other upstream 1300637 21109080 ~ 21128764 (+)
G38079 kif22,LOC107664627 other upstream 1398604 21019169 ~ 21030797 (+)
G37943 NA other upstream 2271062 20155728 ~ 20158339 (+)
LOC103039215 ubtd1b,ubtd1,LOC108437310,LOC107720068 other upstream 2917960 19488899 ~ 19511441 (+)
trnar-ccu_1 NA other downstream 1317453 23747469 ~ 23747541 (+)
trnar-ccu_2 NA other downstream 1317555 23747571 ~ 23747643 (+)
trnar-ccu_3 NA other downstream 1317657 23747673 ~ 23747745 (+)
trnar-ccu_4 NA other downstream 1317759 23747775 ~ 23747847 (+)
trnar-ccu_5 NA other downstream 1317861 23747877 ~ 23747949 (+)

Expression


Co-expression Network