G38611


Basic Information

Item Value
gene id G38611
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 23453364 ~ 23453762 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU52062
ggttagattttagggttgattaagggttaaggttagggttaggtgtagggttagattttagggttgattaagggttaaggttagggttaggtgtagggttcgattttatggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggttagattttagggttgattaagggttaaggt

Function

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:0009611 response to wounding biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process
GO:0042060 wound healing biological_process
GO:0004806 triglyceride lipase activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU52062 True 273 lncRNA 0.39 3 23453364 23453762

Neighbor

gene id symbol gene type direction distance location
tfam NA coding upstream 56986 23387980 ~ 23396378 (+)
LOC111192392 LOC108416223 coding upstream 452741 22998679 ~ 23000623 (+)
dkk1 dkk1 coding upstream 1081877 22368776 ~ 22371487 (+)
prkg1 prkg1,prkg1b,LOC107695529,LOC106589397 coding upstream 1103282 22097751 ~ 22350082 (+)
LOC111192422 NA coding upstream 1355466 22070247 ~ 22097898 (+)
phyhipl phyhipl,phyhiplb,LOC107727060,LOC107746456,LOC107654056,LOC107695536 coding downstream 174925 23628687 ~ 23685558 (+)
LOC111192424 NA coding downstream 947356 24401118 ~ 24402659 (+)
LOC111192396 LOC108411010 coding downstream 1177941 24631703 ~ 24648610 (+)
LOC103037544 adprh,LOC108274007,LOC108411014,LOC105894051,LOC106579059 coding downstream 1198867 24652629 ~ 24663580 (+)
mto1 mto1 coding downstream 1243374 24697136 ~ 24713813 (+)
G38585 ube2d2,ube2d1b,ube2d1,LOC105891213,LOC107717106,LOC107553913,LOC106607701 non-coding upstream 65943 23380968 ~ 23387421 (+)
G38589 NA non-coding upstream 98239 23349878 ~ 23355125 (+)
G38583 NA non-coding upstream 147059 23306058 ~ 23306305 (+)
G38577 NA non-coding upstream 182783 23270185 ~ 23270581 (+)
G38565 NA non-coding upstream 230599 23172492 ~ 23222765 (+)
G38628 NA non-coding downstream 41310 23495072 ~ 23513968 (+)
G38633 NA non-coding downstream 67170 23520932 ~ 23523870 (+)
G38717 NA non-coding downstream 324512 23778274 ~ 23845827 (+)
G38710 NA non-coding downstream 330203 23783965 ~ 23784746 (+)
G38723 NA non-coding downstream 376724 23830486 ~ 23951902 (+)
plce1 plce1,LOC107743958 other upstream 2156541 21166568 ~ 21296823 (+)
lgi1 lgi1,lgi1b,LOC107743957,LOC107664615,LOC107598600,LOC107654035,LOC107708938 other upstream 2324600 21109080 ~ 21128764 (+)
G38079 kif22,LOC107664627 other upstream 2422567 21019169 ~ 21030797 (+)
G37943 NA other upstream 3295025 20155728 ~ 20158339 (+)
LOC103039215 ubtd1b,ubtd1,LOC108437310,LOC107720068 other upstream 3941923 19488899 ~ 19511441 (+)
trnar-ccu_1 NA other downstream 293707 23747469 ~ 23747541 (+)
trnar-ccu_2 NA other downstream 293809 23747571 ~ 23747643 (+)
trnar-ccu_3 NA other downstream 293911 23747673 ~ 23747745 (+)
trnar-ccu_4 NA other downstream 294013 23747775 ~ 23747847 (+)
trnar-ccu_5 NA other downstream 294115 23747877 ~ 23747949 (+)

Expression


Co-expression Network