G52330


Basic Information

Item Value
gene id G52330
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 2401035 ~ 2401380 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU59612
GTCGACGTGCCTGCAGTGGTTCAACCTTAATTTTATGAAGTGACGAGAATACTTTTTGTGCGCAAAAACAAAAAACAATAACGACTTTATTCAACAATATCTTCTCTTCTGTGTCATTCTCATATGTCTAGCACTTCCAGGTTCTACATCAGAACTCTGACTCATTATTGGCCGGCTCCTGCGTCAGCATCACACGCATGCATCGTGCTGCTCACGTGATCAACGTTGGCCAATACTGAGCCGGCATTCAGACGTAAACACGGAAGCGGAAGAGATTGTTGAATAAAGTTGTTATTTTTGTTTTGTTTTGTTTTGTCGCTTCATAACATTAAGGTTGAACCACTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU59612 True 346 lncRNA 0.38 1 2401035 2401380

Neighbor

gene id symbol gene type direction distance location
CI01000009_02391182_02393863 NA coding downstream 7172 2390445 ~ 2393863 (-)
CI01000009_02358636_02361913 HPX coding downstream 39086 2358470 ~ 2361949 (-)
CI01000009_02352214_02356619 NA coding downstream 44194 2352214 ~ 2356841 (-)
CI01000009_02327693_02335035 NA coding downstream 66000 2327693 ~ 2335035 (-)
CI01000009_02300395_02301213 OLIG2 coding downstream 99398 2300109 ~ 2301637 (-)
CI01000009_02403219_02417215 FAM160A2 coding upstream 1776 2403156 ~ 2417215 (-)
CI01000009_02591882_02593586 RPL8.S, RPL8 coding upstream 190483 2591863 ~ 2593761 (-)
CI01000009_02610459_02610721 NA coding upstream 208880 2610260 ~ 2610721 (-)
CI01000009_02654102_02655554 CASK coding upstream 252722 2654102 ~ 2656438 (-)
CI01000009_02682050_02707583 NA coding upstream 280228 2681608 ~ 2707623 (-)
G52328 NA non-coding downstream 141 2399814 ~ 2400894 (-)
G52371 NA non-coding downstream 12496 2388314 ~ 2388539 (-)
G52342 NA non-coding downstream 185500 2214952 ~ 2215535 (-)
G52338 NA non-coding downstream 243289 2157412 ~ 2157746 (-)
G52230 NA non-coding downstream 304983 2094368 ~ 2096052 (-)
G52378 NA non-coding upstream 25869 2427249 ~ 2427848 (-)
G52379 NA non-coding upstream 46986 2448366 ~ 2451640 (-)
G52440 NA non-coding upstream 111577 2512957 ~ 2513671 (-)
G52409 NA non-coding upstream 162382 2563762 ~ 2566564 (-)
G52406 NA non-coding upstream 173106 2574486 ~ 2578978 (-)
G52098 NA other downstream 993408 1401932 ~ 1407627 (-)
G52410 NA other upstream 150344 2551724 ~ 2562533 (-)
CI01000009_02885473_02893975 NA other upstream 482308 2883688 ~ 2893975 (-)
CI01000009_03261739_03262843 NA other upstream 859823 3261038 ~ 3262843 (-)
G52828 NA other upstream 1816040 4217420 ~ 4231469 (-)
G53515 NA other upstream 3101015 5502395 ~ 5505248 (-)

Expression


Co-expression Network