G52488


Basic Information

Item Value
gene id G52488
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 2912305 ~ 2912542 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU59786
AAAGCACTTTTCAGTTTCCTCGCTGCTTTTGTTTTTCGGTCTAAATTTATTATAAAGGAAGGATTTATTCAGTTTCTTTTTTTCTGTTGTCATGTTGTTTTGTCACACATTCTGTTGCCTTTCACTAAATGTCATCTGAAAAGGTTTGCAGGAATCCCCCAGTGAGAAAATAATAATGAGGCCATTTGCAAATTTCACTTGTCCTTCAAGTTATGAAAAAACTGCAGTTATTTTCTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU59786 True 238 lncRNA 0.34 1 2912305 2912542

Neighbor

gene id symbol gene type direction distance location
CI01000009_02885473_02893975 NA coding downstream 18330 2883688 ~ 2893975 (-)
CI01000009_02844171_02861309 MAOB coding downstream 50996 2843011 ~ 2861309 (-)
CI01000009_02786421_02791586 NA coding downstream 119870 2786311 ~ 2792435 (-)
CI01000009_02682050_02707583 NA coding downstream 204682 2681608 ~ 2707623 (-)
CI01000009_02654102_02655554 CASK coding downstream 255867 2654102 ~ 2656438 (-)
CI01000009_02916137_02917550 FUNDC1 coding upstream 3099 2915641 ~ 2917550 (-)
CI01000009_02975388_02982670 NA coding upstream 62846 2975388 ~ 2985391 (-)
CI01000009_03006152_03007243 NA coding upstream 92844 3005386 ~ 3007855 (-)
CI01000009_03009238_03025860 NA coding upstream 95818 3008360 ~ 3025937 (-)
CI01000009_03140599_03143635 SLC35A5 coding upstream 228057 3140599 ~ 3143635 (-)
G52478 NA non-coding downstream 88377 2822962 ~ 2823928 (-)
G52469 NA non-coding downstream 100971 2811045 ~ 2811334 (-)
G52406 NA non-coding downstream 333327 2574486 ~ 2578978 (-)
G52409 NA non-coding downstream 345741 2563762 ~ 2566564 (-)
G52440 NA non-coding downstream 398634 2512957 ~ 2513671 (-)
G52489 NA non-coding upstream 576 2913118 ~ 2913345 (-)
G52553 NA non-coding upstream 83107 2995649 ~ 2995905 (-)
G52503 NA non-coding upstream 93022 3027695 ~ 3033677 (-)
G52556 NA non-coding upstream 133347 3045889 ~ 3046097 (-)
G52410 NA other downstream 349772 2551724 ~ 2562533 (-)
G52098 NA other downstream 1504678 1401932 ~ 1407627 (-)
CI01000009_03261739_03262843 NA other upstream 348661 3261038 ~ 3262843 (-)
G52828 NA other upstream 1304878 4217420 ~ 4231469 (-)
G53515 NA other upstream 2589853 5502395 ~ 5505248 (-)
G55814 NA other upstream 5513279 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 5945610 8856310 ~ 8860563 (-)

Expression


Co-expression Network