G52593


Basic Information

Item Value
gene id G52593
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 3222632 ~ 3222961 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU59914
TTTTAATAGGTTTTAAAAGTAACCAAAATGCTAAACATTAAAATTAAAGCAGAACAAACATGAACGGAAATGTTTGATACAAGCTTGTTCAGTTTGGTTATGACCTGATGTCACTTTTATATTTTTAAGCTCTAGGAAATATGAATGTGAAGTGAATTTGTGGTCTCGTTGATAGAAGATTTTGGCCATATTGCCCATCCAAGTCATTCATTCCGGTATGGCAGGCTCGTCAGTAGGCTACACTTCTTGTATTTCGGGCACACCACAAGGTGTCACTGTGGCCTCAATGCTTCGTCCTCGCCTACTCTGAGCTCGATTGCTATGTCTGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU59914 True 330 lncRNA 0.39 1 3222632 3222961

Neighbor

gene id symbol gene type direction distance location
CI01000009_03171440_03194494 DCAF6 coding downstream 27487 3171440 ~ 3195145 (-)
CI01000009_03140599_03143635 SLC35A5 coding downstream 78997 3140599 ~ 3143635 (-)
CI01000009_03009238_03025860 NA coding downstream 196695 3008360 ~ 3025937 (-)
CI01000009_03006152_03007243 NA coding downstream 214777 3005386 ~ 3007855 (-)
CI01000009_02975388_02982670 NA coding downstream 237241 2975388 ~ 2985391 (-)
CI01000009_03226613_03234223 ME3.L, ME3 coding upstream 2807 3225768 ~ 3234223 (-)
CI01000009_03235111_03242103 NA coding upstream 12053 3235014 ~ 3242103 (-)
CI01000009_03244366_03259106 ILDR2 coding upstream 20637 3243598 ~ 3259106 (-)
CI01000009_03261739_03262843 NA coding upstream 38077 3261038 ~ 3262843 (-)
CI01000009_03264437_03267242 NA coding upstream 41476 3264437 ~ 3267242 (-)
G52521 NA non-coding downstream 690 3220732 ~ 3221942 (-)
G52496 NA non-coding downstream 15206 3202765 ~ 3207426 (-)
G52494 NA non-coding downstream 66486 3150263 ~ 3156146 (-)
G52589 NA non-coding downstream 73200 3147928 ~ 3149432 (-)
G52518 NA non-coding downstream 140195 3081991 ~ 3082437 (-)
G52592 NA non-coding upstream 529 3223490 ~ 3223799 (-)
G52513 NA non-coding upstream 55783 3278744 ~ 3279333 (-)
G52501 NA non-coding upstream 64357 3287318 ~ 3290823 (-)
G52606 NA non-coding upstream 77988 3300949 ~ 3302661 (-)
G52623 NA non-coding upstream 159023 3381984 ~ 3386060 (-)
CI01000009_02885473_02893975 NA other downstream 323225 2883688 ~ 2893975 (-)
G52410 NA other downstream 660099 2551724 ~ 2562533 (-)
G52098 NA other downstream 1815005 1401932 ~ 1407627 (-)
G52828 NA other upstream 994459 4217420 ~ 4231469 (-)
G53515 NA other upstream 2279434 5502395 ~ 5505248 (-)
G55814 NA other upstream 5202860 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 5635191 8856310 ~ 8860563 (-)

Expression


Co-expression Network