G52735


Basic Information

Item Value
gene id G52735
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 3730900 ~ 3731251 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU60066
CTCAAGGGAGTGGAAATACTTCAAATTTATGATGATAACACACACATTGCGAACTGCATGCTTTCAATCACAATTCGTTATCGATTAGTGAAGGCGAGATAGGCGGAGTCGCGCTGAATGACAGACCAGAAGCGCTCCCTCTCGCGCGCGATCCCAGTTCTCTCAGACAGCGCGCAATCAGTTCTCCTTGCGCCTGAATGGTCAAATGCACACATAGTTGTCAAAATGTCCATCATGTGGAGTATCTCACGTAAATACAGTAGGTTATGGCTTAAGTGGACGTAAACATTTGGGTGAAAACAGGATAAGTGTCAGTAACCATGGATTCGGTCTTAAAGGGACCGCAGCCTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU60066 True 352 lncRNA 0.45 1 3730900 3731251

Neighbor

gene id symbol gene type direction distance location
CI01000009_03699312_03715114 APP, APPB, APPA coding downstream 15786 3699312 ~ 3715114 (-)
CI01000009_03668956_03672426 NA coding downstream 58474 3668792 ~ 3672426 (-)
CI01000009_03664045_03666052 NA coding downstream 64163 3663947 ~ 3666737 (-)
CI01000009_03643048_03645741 DCNL2, DCUN1D2, DCUN1D2A coding downstream 83740 3642248 ~ 3647160 (-)
CI01000009_03633868_03640910 CDC16 coding downstream 89990 3633704 ~ 3640910 (-)
CI01000009_03770045_03770497 NA coding upstream 38659 3769910 ~ 3770497 (-)
CI01000009_03791699_03858262 NCAM2 coding upstream 59447 3790698 ~ 3859234 (-)
CI01000009_04015167_04016764 NA coding upstream 283754 4015005 ~ 4016837 (-)
CI01000009_04069741_04071278 NA coding upstream 338463 4069714 ~ 4071604 (-)
CI01000009_04196309_04197268 DNAJC28 coding upstream 465058 4196309 ~ 4197268 (-)
G52725 NA non-coding downstream 82921 3647714 ~ 3647979 (-)
G52670 NA non-coding downstream 276350 3454343 ~ 3454550 (-)
G52639 NA non-coding downstream 324024 3406663 ~ 3406876 (-)
G52623 NA non-coding downstream 344840 3381984 ~ 3386060 (-)
G52606 NA non-coding downstream 428239 3300949 ~ 3302661 (-)
G52736 NA non-coding upstream 62 3731313 ~ 3731533 (-)
G52739 NA non-coding upstream 4572 3735823 ~ 3736139 (-)
G52743 NA non-coding upstream 12076 3743327 ~ 3743553 (-)
G52770 NA non-coding upstream 316572 4047823 ~ 4048261 (-)
G52773 NA non-coding upstream 331980 4063231 ~ 4063661 (-)
CI01000009_03261739_03262843 NA other downstream 468943 3261038 ~ 3262843 (-)
CI01000009_02885473_02893975 NA other downstream 831493 2883688 ~ 2893975 (-)
G52410 NA other downstream 1168367 2551724 ~ 2562533 (-)
G52098 NA other downstream 2323273 1401932 ~ 1407627 (-)
G52828 NA other upstream 486169 4217420 ~ 4231469 (-)
G53515 NA other upstream 1771144 5502395 ~ 5505248 (-)
G55814 NA other upstream 4694570 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 5126901 8856310 ~ 8860563 (-)
G59097 NA other upstream 8556966 12288217 ~ 12289518 (-)

Expression


Co-expression Network