G107261


Basic Information

Item Value
gene id G107261
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035908.1
NCBI id CM008311.1
chromosome length 31403898
location 30401626 ~ 30464931 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU144919
agtgtgtgtgtgtgtgtgtcccaaacattcacacaaagcaatccagactgttctcatacagagttccccaatggtggaacaaactaccttccactaccagatcaggagaatctctcgctatctttaagaaactcctgaagacagagctcttcaaagagcacttactctcttaacacctctaacacactaactacttctaacctcatttccttcttcctctccttcactcctctatcctattactccccttgtcctccttttatccctatccaaagatgttttaccttgaaacttattttacattgtacttgactattgtaagtcgctttggacaaaagcgtctgccaaatgtaatgtaatgtaatgtaatgtaatgtaaagaactccccctatcactagtgatgccccaacattatgagggtaaagactagcacacgcctcttccgacaca

Function

NR:

description
PREDICTED: transmembrane and coiled-coil domains protein 3-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU144919 True 451 lncRNA 0.41 2 30401626 30464931

Neighbor

gene id symbol gene type direction distance location
LOC111193470 NA coding upstream 743204 29656537 ~ 29658422 (+)
LOC103025432 NA coding upstream 813504 29563196 ~ 29588122 (+)
donson LOC107555241 coding upstream 843583 29538337 ~ 29558043 (+)
LOC103025657 runx1,LOC108429862,LOC107571884 coding upstream 881792 29417222 ~ 29519834 (+)
LOC103024513 LOC107555266,LOC106574727,LOC106575573,LOC108429863,LOC107568777,LOC107709315,LOC107718016,LOC105889574,LOC100333907 coding upstream 1160029 29208551 ~ 29241597 (+)
LOC111193471 NA coding downstream 75330 30540261 ~ 30547361 (+)
LOC111193577 LOC108429857,LOC108258902 coding downstream 197068 30661999 ~ 30668744 (+)
gart gart coding downstream 207221 30672152 ~ 30711252 (+)
adamts5 adamts5,LOC107751075,LOC107698897 coding downstream 796349 31261280 ~ 31300421 (+)
adamts1 adamts1,LOC107698918,LOC107751074 coding downstream 847809 31312740 ~ 31319149 (+)
G107250 NA non-coding upstream 202682 30198295 ~ 30198944 (+)
G107243 NA non-coding upstream 233502 30167318 ~ 30168124 (+)
G107207 NA non-coding upstream 303879 30094167 ~ 30097747 (+)
G107175 NA non-coding upstream 319215 30018964 ~ 30082411 (+)
G107267 NA non-coding downstream 28070 30493001 ~ 30528484 (+)
G107342 NA non-coding downstream 250249 30715180 ~ 30716606 (+)
G107389 NA non-coding downstream 267737 30732668 ~ 30732900 (+)
G107394 NA non-coding downstream 278746 30743677 ~ 30744047 (+)
G107396 NA non-coding downstream 280500 30745431 ~ 30745631 (+)
G107117 NA other upstream 620699 29780326 ~ 29780927 (+)
LOC111193573 NA other upstream 1241946 29149065 ~ 29159680 (+)
LOC103027743 NA other upstream 1677600 28703067 ~ 28724026 (+)
G106673 NA other upstream 2334643 28066352 ~ 28066983 (+)
G106661 lancl1 other upstream 2379579 28014516 ~ 28022047 (+)

Expression


Co-expression Network