G107450


Basic Information

Item Value
gene id G107450
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035908.1
NCBI id CM008311.1
chromosome length 31403898
location 31162526 ~ 31163507 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU145140
ccgctgctaaggttttggaggccctaagcataactggtcttatcatcgaagttactcaccagaaagggatgcatgggcctcatctttctgcttctttttcttcttctcagctccagactcaaaccgtcgcttcatagttgaattaccatttagtagcaacttcgcgcagtgaacttgtctcctgccaaactcaagtagcgttgctactttagttaggactaaggttgccagataagttacgatttttcatcctatttgtttattttattttaagtttttaacttacacaaatattgcactggacaagtttttgtatagaatggccacatacactttaaaaatggttaaacatgcgcaagatttagcgcctccatgcattttttgattatttatttgactggaaaatgtcacatctggca

Function

NR:

description
PREDICTED: high mobility group protein B1-like

GO: NA

KEGG:

id description
ko04975 Fat digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU145140 True 419 lncRNA 0.39 2 31162526 31163507

Neighbor

gene id symbol gene type direction distance location
gart gart coding upstream 451274 30672152 ~ 30711252 (+)
LOC111193577 LOC108429857,LOC108258902 coding upstream 493782 30661999 ~ 30668744 (+)
LOC111193471 NA coding upstream 615165 30540261 ~ 30547361 (+)
ncam2 ncam2,LOC107721821,LOC107698913,LOC107751079 coding upstream 710925 29844100 ~ 30451601 (+)
LOC111193470 NA coding upstream 1504104 29656537 ~ 29658422 (+)
adamts5 adamts5,LOC107751075,LOC107698897 coding downstream 97773 31261280 ~ 31300421 (+)
adamts1 adamts1,LOC107698918,LOC107751074 coding downstream 149233 31312740 ~ 31319149 (+)
cyyr1 cyyr1,LOC107751099 coding downstream 162187 31325694 ~ 31341351 (+)
app app,appa,LOC108258852,LOC107593741,LOC107698920 coding downstream 183794 31347301 ~ 31402273 (+)
G107448 NA non-coding upstream 8827 31153480 ~ 31153699 (+)
G107446 NA non-coding upstream 10952 31150998 ~ 31151574 (+)
G107432 NA non-coding upstream 208117 30953299 ~ 30954409 (+)
G107430 NA non-coding upstream 231718 30930563 ~ 30930808 (+)
G107424 NA non-coding upstream 248653 30913537 ~ 30913873 (+)
G107454 NA non-coding downstream 14579 31178086 ~ 31178343 (+)
G107463 NA non-coding downstream 38490 31201997 ~ 31202224 (+)
G107482 NA non-coding downstream 125228 31288735 ~ 31289411 (+)
G107117 NA other upstream 1381599 29780326 ~ 29780927 (+)
LOC111193573 NA other upstream 2002846 29149065 ~ 29159680 (+)
LOC103027743 NA other upstream 2438500 28703067 ~ 28724026 (+)
G106673 NA other upstream 3095543 28066352 ~ 28066983 (+)
G106661 lancl1 other upstream 3140479 28014516 ~ 28022047 (+)

Expression


Co-expression Network