G53916


Basic Information

Item Value
gene id G53916
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 5585039 ~ 5596678 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU61390
CGAAGACCCAGATCACCCGTGTCACGCTCACATGGAGTTGCTCGCGGACAGGCCTGTAACCCTGAGTGATATAGAGCTGGTTTTCTTTACCAAACTCTGATGGGAGAGAGATGACAATGAAGGTGAACTAGGGGAAATGGCGGTCAAGACAGGGTGAATGAAGACGTACACTCATGATCTCCATTGTTCCGATGCTCTGCAGAAATATATTGATCAAAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU61390 True 220 lncRNA 0.48 2 5585039 5596678

Neighbor

gene id symbol gene type direction distance location
CI01000009_05513478_05515588 NA coding downstream 69451 5513269 ~ 5515588 (-)
CI01000009_05402729_05410456 NA coding downstream 174583 5402504 ~ 5410456 (-)
CI01000009_05367161_05370504 PTPLB, HACD2, DKFZP459B2333 coding downstream 214535 5365766 ~ 5370504 (-)
CI01000009_05362086_05363378 NA coding downstream 220958 5362042 ~ 5364081 (-)
CI01000009_05278137_05361256 ADCY5 coding downstream 223561 5277137 ~ 5361478 (-)
CI01000009_05675971_05682578 NA coding upstream 79094 5675772 ~ 5683383 (-)
CI01000009_05724421_05725824 NA coding upstream 127163 5723841 ~ 5725834 (-)
CI01000009_05759177_05759509 NA coding upstream 162321 5758999 ~ 5759770 (-)
CI01000009_05784097_05785842 FZD5 coding upstream 187387 5784065 ~ 5785842 (-)
CI01000009_05798886_05836104 PLEKHM3 coding upstream 201204 5797882 ~ 5838430 (-)
G53566 NA non-coding downstream 31938 5552890 ~ 5553101 (-)
G53556 NA non-coding downstream 38402 5539205 ~ 5546637 (-)
G53552 NA non-coding downstream 45351 5523644 ~ 5539688 (-)
G53514 NA non-coding downstream 76250 5506972 ~ 5508789 (-)
G53515 NA non-coding downstream 81649 5502395 ~ 5505248 (-)
G53988 NA non-coding upstream 133956 5730634 ~ 5730864 (-)
G53997 NA non-coding upstream 149897 5746575 ~ 5746788 (-)
G54000 NA non-coding upstream 155262 5751940 ~ 5752165 (-)
G54032 NA non-coding upstream 396507 5993185 ~ 5993404 (-)
G54065 NA non-coding upstream 422368 6019046 ~ 6019356 (-)
G52828 NA other downstream 1353570 4217420 ~ 4231469 (-)
CI01000009_03261739_03262843 NA other downstream 2323082 3261038 ~ 3262843 (-)
CI01000009_02885473_02893975 NA other downstream 2685632 2883688 ~ 2893975 (-)
G52410 NA other downstream 3022506 2551724 ~ 2562533 (-)
G55814 NA other upstream 2829143 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 3261474 8856310 ~ 8860563 (-)
G59097 NA other upstream 6691539 12288217 ~ 12289518 (-)
CI01000009_13975122_13976026 NA other upstream 8378710 13975099 ~ 13978614 (-)
G59490 NA other upstream 8436886 14033564 ~ 14037873 (-)

Expression


Co-expression Network