G53676


Basic Information

Item Value
gene id G53676
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 5780584 ~ 5781118 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU61133
GGAATTTCCCTTTCAGACGCAAAATTTATGGGAGGACAGTATTTAAATGAATCATGCAAAGTGATTTACTAAGGTTTGTGCTAGTCAAATTACTGGTATTTTATTGGTGTTTATTGCGCCATTATTTACCGCCCAAAAAAAGCTTAAGTCTTAAACCAGATGCTAATTTGTGCTGCTCTTGGTAGATTGCATTGGTCATTATGGAAATGATCCGGCTTCATCTCTGTTCTTTAATTTGCGTGTCATCAGTACTGTAGATCACGTGCAGAACTTTCCACTCCCATCAGCGCTTTTTTGGAATTGCGCTTTCACTCTAATTTGCCGTGTTTTTTTTTAACCAAATGAATACTTGTGACTGTAAAGACAAATAAATGTTGTTCTTTTGAACTTTCTATTTAAAGAATCCTGACAAAAACAATCACTGTTTCCTCAAAAAATATTAAGTAACAAAACTGTTTTCAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU61133 True 463 lncRNA 0.35 2 5780584 5781118

Neighbor

gene id symbol gene type direction distance location
CI01000009_05761849_05767932 CREB1, CREB1A, CREB1B coding upstream 11881 5760983 ~ 5768703 (+)
CI01000009_05704310_05721474 KLF7, KLF7A, KLF7B coding upstream 58578 5703993 ~ 5722006 (+)
CI01000009_05696405_05703318 NA coding upstream 76663 5695671 ~ 5703921 (+)
CI01000009_05685508_05688628 NA coding upstream 91951 5685508 ~ 5688633 (+)
CI01000009_05538212_05539688 NA coding upstream 240896 5538212 ~ 5539727 (+)
CI01000009_05931829_05943829 KCNH3 coding downstream 150600 5931718 ~ 5943899 (+)
CI01000009_05968963_05974380 DBR1 coding downstream 186341 5967459 ~ 5974750 (+)
CI01000009_05983361_05989883 TBCCD1 coding downstream 202243 5983361 ~ 5990583 (+)
CI01000009_05992944_05994452 CRYGS, CRYGS1, CRYGS2 coding downstream 211826 5992944 ~ 5994492 (+)
CI01000009_06002120_06017019 GTF2E1 coding downstream 221002 6002120 ~ 6017782 (+)
G53637 NA non-coding upstream 33633 5746575 ~ 5746951 (+)
G53632 NA non-coding upstream 38118 5742252 ~ 5742466 (+)
G53584 NA non-coding upstream 197899 5582457 ~ 5582685 (+)
G53402 NA non-coding upstream 206718 5573634 ~ 5573866 (+)
G53396 NA non-coding upstream 225594 5554770 ~ 5554990 (+)
G53646 NA non-coding downstream 62931 5844049 ~ 5845824 (+)
G53675 NA non-coding downstream 78079 5859197 ~ 5895612 (+)
G53723 NA non-coding downstream 255078 6036196 ~ 6036429 (+)
G53733 NA non-coding downstream 264403 6045521 ~ 6045723 (+)
G53666 NA non-coding downstream 283949 6065067 ~ 6095605 (+)
G53388 NA other upstream 241530 5522242 ~ 5540638 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other upstream 2571600 3202207 ~ 3208984 (+)
G51529 NA other upstream 2717997 3062033 ~ 3062587 (+)
G51274 NA other upstream 3430098 2255099 ~ 2350486 (+)
CI01000009_01897343_01919208 PIKFYVE other upstream 3879158 1897343 ~ 1919516 (+)
G53651 NA other downstream 464446 6245564 ~ 6248392 (+)
G56100 NA other downstream 3348182 9129300 ~ 9130286 (+)
CI01000009_09853929_09854476 SAP18 other downstream 4072241 9853929 ~ 9856587 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 5979668 11761606 ~ 11766944 (+)

Expression


Co-expression Network