G54433


Basic Information

Item Value
gene id G54433
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 6632544 ~ 6632778 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU61960
TGAGGTTCTCATTTTTAAGTTTCCTTAAGAGGTTTTTCTTTTGACTTGTTCAGCTCTTTAATAGAAATCTTTTACAATGTGACCATTATGTCTTTTTTCCAGCTGCCTGTAATTGTATTTTAAGCCCTCATTATTCCAACCCAGTCGCACTTCAAGGTTTGAGTGTGATAAAAAGGTATGTTAATTAAAACAGCGCTATCCCAAATTCAAGCTGTCTTTATCATTTTCTTTTCTC

Function

NR:

description
PREDICTED: E3 SUMO-protein ligase PIAS1-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU61960 True 235 lncRNA 0.34 1 6632544 6632778

Neighbor

gene id symbol gene type direction distance location
CI01000009_06212264_06213131 NA coding upstream 418729 6212264 ~ 6213815 (+)
CI01000009_06205817_06207701 TEX30 coding upstream 424833 6205817 ~ 6207711 (+)
CI01000009_06195742_06204011 KDELC1 coding upstream 428195 6195742 ~ 6204349 (+)
CI01000009_06130188_06193279 STXBP5L coding upstream 439140 6130064 ~ 6193404 (+)
CI01000009_06002120_06017019 GTF2E1 coding upstream 614762 6002120 ~ 6017782 (+)
CI01000009_06943591_06952628 NA coding downstream 308846 6941624 ~ 6953067 (+)
CI01000009_06975071_07009147 ARHGAP15 coding downstream 342293 6975071 ~ 7009417 (+)
CI01000009_07051811_07054331 NA coding downstream 417940 7050718 ~ 7054625 (+)
CI01000009_07091022_07092696 NA coding downstream 458140 7090918 ~ 7092801 (+)
CI01000009_07101768_07105835 NA coding downstream 468491 7101269 ~ 7106009 (+)
G53903 NA non-coding upstream 55402 6576716 ~ 6577142 (+)
G53901 NA non-coding upstream 61931 6570411 ~ 6570613 (+)
G53890 NA non-coding upstream 95161 6537149 ~ 6537383 (+)
G53886 NA non-coding upstream 102275 6519899 ~ 6530269 (+)
G53669 NA non-coding upstream 388176 6215668 ~ 6244368 (+)
G54627 NA non-coding downstream 172529 6805307 ~ 6913596 (+)
G54626 NA non-coding downstream 263343 6896121 ~ 6940792 (+)
G54687 NA non-coding downstream 313045 6945823 ~ 6946041 (+)
G54694 NA non-coding downstream 324941 6957719 ~ 6957928 (+)
CI01000009_07111833_07115320 NA non-coding downstream 437973 7110351 ~ 7115443 (+)
G53651 NA other upstream 384152 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 699743 5931718 ~ 5943899 (+)
G53388 NA other upstream 1093490 5522242 ~ 5540638 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other upstream 3423560 3202207 ~ 3208984 (+)
G51529 NA other upstream 3569957 3062033 ~ 3062587 (+)
G56100 NA other downstream 2496522 9129300 ~ 9130286 (+)
CI01000009_09853929_09854476 SAP18 other downstream 3220581 9853929 ~ 9856587 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 5128008 11761606 ~ 11766944 (+)
G57811 NA other downstream 5301164 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 5799780 12432538 ~ 12436017 (+)

Expression


Co-expression Network