G54839


Basic Information

Item Value
gene id G54839
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 6952942 ~ 6953189 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU62401
TAAATATTTAAAACGTGTCCCCATTCCTTTCGTCTCTTGTGAGAGTCAAACACATCAATTTGCACTCAAAAAAGCACAAACAGAGGACTGAAGTGTGTAGAGAAAGAAAACGGCTCCTTTATTTTAACTTCTAAGCGGTTTCACCGCAAATTGAAGCGTGAAGACGACAGCACAATTAGCAGGCGCAGAAGGAGGGATGGGAATGAGCTTGTGAAAAGCCGAGCGAAAGAAAGGCAAAAGGATACAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU62401 True 248 lncRNA 0.42 1 6952942 6953189

Neighbor

gene id symbol gene type direction distance location
CI01000009_06913437_06917631 NA coding downstream 35311 6912470 ~ 6917631 (-)
CI01000009_06891877_06908223 EFNB2A, EFNB2 coding downstream 44719 6891241 ~ 6908223 (-)
CI01000009_06253421_06255264 NA coding downstream 696996 6253421 ~ 6255946 (-)
CI01000009_06250463_06251001 NA coding downstream 701941 6250286 ~ 6251001 (-)
CI01000009_06246303_06248176 SLC10A2 coding downstream 704766 6245570 ~ 6248176 (-)
CI01000009_07020336_07047155 NA coding upstream 67126 7020315 ~ 7048177 (-)
CI01000009_07064060_07084764 ZEB2A coding upstream 110608 7063797 ~ 7085218 (-)
CI01000009_07224625_07229839 NA coding upstream 271127 7224316 ~ 7230651 (-)
CI01000009_07383927_07391805 ITM2B coding upstream 430465 7383654 ~ 7391994 (-)
CI01000009_07500752_07541007 LRCH1 coding upstream 547413 7500602 ~ 7541007 (-)
G54836 NA non-coding downstream 1519 6951207 ~ 6951423 (-)
G54499 NA non-coding downstream 304651 6648087 ~ 6648291 (-)
G54488 NA non-coding downstream 319942 6632801 ~ 6633000 (-)
G54417 NA non-coding downstream 378774 6573910 ~ 6574168 (-)
G54411 NA non-coding downstream 383108 6569625 ~ 6569834 (-)
G54849 NA non-coding upstream 8764 6961953 ~ 6962172 (-)
G54877 NA non-coding upstream 163185 7116374 ~ 7116639 (-)
G54878 NA non-coding upstream 165339 7118528 ~ 7118767 (-)
G54887 NA non-coding upstream 174173 7127362 ~ 7127584 (-)
G54900 NA non-coding upstream 188540 7141729 ~ 7141964 (-)
G53515 NA other downstream 1447694 5502395 ~ 5505248 (-)
G52828 NA other downstream 2721473 4217420 ~ 4231469 (-)
CI01000009_03261739_03262843 NA other downstream 3690985 3261038 ~ 3262843 (-)
CI01000009_02885473_02893975 NA other downstream 4053535 2883688 ~ 2893975 (-)
G52410 NA other downstream 4390409 2551724 ~ 2562533 (-)
G55814 NA other upstream 1472632 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 1904963 8856310 ~ 8860563 (-)
G59097 NA other upstream 5335028 12288217 ~ 12289518 (-)
CI01000009_13975122_13976026 NA other upstream 7022199 13975099 ~ 13978614 (-)
G59490 NA other upstream 7080375 14033564 ~ 14037873 (-)

Expression


Co-expression Network