G164540 (spopla,LOC108412981,LOC107658226,LOC107556446,LOC107558043,LOC107720326,LOC107751611,LOC108270802)


Basic Information

Item Value
gene id G164540
gene name spopla,LOC108412981,LOC107658226,LOC107556446,LOC107558043,LOC107720326,LOC107751611,LOC108270802
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035915.1
NCBI id CM008318.1
chromosome length 35429340
location 2496597 ~ 2501144 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU222842
CTCACAGAACAGAGTCAGTTTATCATCAGGAAGCAGCCCGTTCGCTTCATCCAGCAGAAAATCTCTTCTAATAAACTTCTTGAAGCCCCAGTCTTTGCCTTGGACGAACCGGTAGGCTCTTTGGCTTTCCATAGCTTTAGTCTCCTCACGCTTAGCGTTCAGTAAAGAAAACTTGAACTTGGCTCGGACTTCACTTTTTGGACAGCTAACCAGCAGCAAATACAGTGACAGGTAATCCTTACTTTCATCATCTAGTCCCTTTGGATTGACTCTCAGACACCATTTCATCTTATCGTTGGGACCTGAACAGAAAGATGAGCTTTTCAGAACTTCCCCCATCTCCTCTCGACAGAAGCTGAAGTTGTTGATGGTCCACATATAGGAAAACTTCACTACTTTCACCTGGGTGTAGCACCAGCTCTCAGCCACCGGGCCGCTGCCCATCTCCACCGGGGGAGGAGGGGTGGGGACTCCCGACATGGCCAGCTCAGTCCCCCT

Function

symbol description
spopla Predicted to enable ubiquitin protein ligase binding activity. Predicted to be involved in negative regulation of protein ubiquitination; proteasome-mediated ubiquitin-dependent protein catabolic process; and regulation of proteolysis. Predicted to be part of Cul3-RING ubiquitin ligase complex. Predicted to be active in cytoplasm and nucleus. Orthologous to human SPOPL (speckle type BTB/POZ protein like).

NR:

description
PREDICTED: LOW QUALITY PROTEIN: speckle-type POZ protein-like B

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU222842 True 498 lncRNA 0.49 4 2496597 2501144

Neighbor

gene id symbol gene type direction distance location
LOC103024889 nxph2,LOC108413064 coding upstream 22700 2440656 ~ 2473897 (+)
znf804a znf804a coding upstream 304683 2093349 ~ 2191914 (+)
LOC111194854 NA coding upstream 613904 1880148 ~ 1882693 (+)
nup35 nup35,LOC106582498,LOC107749876 coding upstream 617742 1870486 ~ 1878855 (+)
ehhadh NA coding upstream 674377 1806395 ~ 1822220 (+)
kansl1l NA coding downstream 102914 2604058 ~ 2655714 (+)
map2 map2 coding downstream 159311 2660455 ~ 2875066 (+)
cps1 cps1 coding downstream 410863 2912007 ~ 3011890 (+)
LOC103033219 NA coding downstream 1538842 4039986 ~ 4043593 (+)
vwc2l vwc2l,LOC107660607 coding downstream 1877878 4379022 ~ 4448620 (+)
G164537 NA non-coding upstream 9402 2483563 ~ 2487195 (+)
G164518 NA non-coding upstream 89045 2402534 ~ 2407552 (+)
G164516 NA non-coding upstream 94578 2398876 ~ 2402019 (+)
G164505 NA non-coding upstream 106820 2388628 ~ 2389777 (+)
G164510 NA non-coding upstream 125172 2371196 ~ 2371425 (+)
G164590 NA non-coding downstream 155978 2657122 ~ 2732983 (+)
G164610 NA non-coding downstream 191449 2692593 ~ 2693184 (+)
G164633 NA non-coding downstream 270202 2771346 ~ 2771853 (+)
G164635 NA non-coding downstream 280521 2781665 ~ 2783595 (+)
G164638 NA non-coding downstream 316880 2818024 ~ 2915105 (+)
G164539 spopl,LOC107751611,LOC108413068,LOC102233870 other upstream 3606 2490044 ~ 2492991 (+)
LOC103028062 cunh3orf70,zgc:162707,LOC107668408,LOC107749877,LOC107752906,LOC107596553,LOC107592986 other upstream 658510 1802787 ~ 1838087 (+)
tspear tspear other upstream 736037 1744406 ~ 1760560 (+)
LOC103047444 myo10l3,LOC108413799,LOC102206624,LOC102799206,LOC101480403,LOC102301787,LOC107087138,LOC108240768,LOC107677785,LOC107752883 other upstream 1000217 1404101 ~ 1496380 (+)
G164126 NA other upstream 1924404 538279 ~ 572193 (+)
LOC103021746 LOC108436791,LOC107721608 other downstream 2766895 5268039 ~ 5298728 (+)
LOC107196936 NA other downstream 3616220 6117364 ~ 6123051 (+)
G165406 NA other downstream 3643793 6144937 ~ 6145969 (+)
LOC111194881 NA other downstream 3659256 6160400 ~ 6237986 (+)
wdr4 wdr4 other downstream 3838851 6339995 ~ 6345403 (+)

Expression


Co-expression Network