G54900



Basic Information


Item Value
gene id G54900
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 7141729 ~ 7141964 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU62467
GCATGTGAGCATCAGAACTGGACCATGGAGCAATGGAAGAAGGTGGCCTGGTCTGATGAATCACGTTTTCTTTTACATCACGTGGATGGCCGGGTGCATGTGCGTCACTTACCTGGGGAACACATGGCACCAGGATGCACTATGGGAAGAAGGCAAGCCGGCAGAGGCAGTGTGATGCTTTGGGCAATGTTCTGCTGGGAAACCTTGGGTCCTGCCATCCATGTGGATGTTACTCT

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU62467 True 236 lncRNA 0.53 1 7141729 7141964

Neighbor


gene id symbol gene type direction distance location
CI01000009_07064060_07084764 ZEB2A coding downstream 56511 7063797 ~ 7085218 (-)
CI01000009_07020336_07047155 NA coding downstream 93552 7020315 ~ 7048177 (-)
CI01000009_06913437_06917631 NA coding downstream 224098 6912470 ~ 6917631 (-)
CI01000009_06891877_06908223 EFNB2A, EFNB2 coding downstream 233506 6891241 ~ 6908223 (-)
CI01000009_06253421_06255264 NA coding downstream 885783 6253421 ~ 6255946 (-)
CI01000009_07224625_07229839 NA coding upstream 82352 7224316 ~ 7230651 (-)
CI01000009_07383927_07391805 ITM2B coding upstream 241690 7383654 ~ 7391994 (-)
CI01000009_07500752_07541007 LRCH1 coding upstream 358638 7500602 ~ 7541007 (-)
CI01000009_07625693_07637462 SLC39A10 coding upstream 483590 7625554 ~ 7637462 (-)
CI01000009_07953250_07953748 NA coding upstream 810754 7952718 ~ 7954139 (-)
G54887 NA non-coding downstream 14145 7127362 ~ 7127584 (-)
G54878 NA non-coding downstream 22962 7118528 ~ 7118767 (-)
G54877 NA non-coding downstream 25090 7116374 ~ 7116639 (-)
G54849 NA non-coding downstream 179557 6961953 ~ 6962172 (-)
G54839 NA non-coding downstream 188540 6952942 ~ 6953189 (-)
G54917 NA non-coding upstream 14807 7156771 ~ 7157175 (-)
G55110 NA non-coding upstream 29133 7171097 ~ 7171518 (-)
G55121 NA non-coding upstream 40918 7182882 ~ 7183239 (-)
G55143 NA non-coding upstream 69968 7211932 ~ 7212295 (-)
G55151 NA non-coding upstream 80344 7222308 ~ 7222523 (-)
G53515 NA other downstream 1636481 5502395 ~ 5505248 (-)
G52828 NA other downstream 2910260 4217420 ~ 4231469 (-)
CI01000009_03261739_03262843 NA other downstream 3879772 3261038 ~ 3262843 (-)
CI01000009_02885473_02893975 NA other downstream 4242322 2883688 ~ 2893975 (-)
G52410 NA other downstream 4579196 2551724 ~ 2562533 (-)
G55814 NA other upstream 1283857 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 1716188 8856310 ~ 8860563 (-)
G59097 NA other upstream 5146253 12288217 ~ 12289518 (-)
CI01000009_13975122_13976026 NA other upstream 6833424 13975099 ~ 13978614 (-)
G59490 NA other upstream 6891600 14033564 ~ 14037873 (-)

Expression



Co-expression Network