G57037


Basic Information

Item Value
gene id G57037
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 9032227 ~ 9032750 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU64971
TAACATGCATATTGTATGATCCCTCTTATTTTGTTAAAATTATTCACATTTTCACAGATTCTGCAAGGGGTTCACAAACTTTCAAGCAGCACTGTATGTTTTTGCTTCTTTAACTACATGTGCAATATTAAAGCTAATAATAATCACAAATGTGTATGGAGTTTTTGTACATTTCAAAAACTCTTATAAAACAGTTTTTACACTCTCACTAGTTTAATTTTCCTAGTAACATTGTCCAAAAGTGTATTTAATGTTTTACAGTGTTTTAATGTGACCATCATTTAACAAAAATAAATAAGTTGAAATCTCTTGATTTTAATAGAAATAAACCTATTGGACATATAAAGTGCATATAAACACTTATTTACTTAGAATTACTATTTCTGAAATTAGGCCTATGACAAAGATGATTGCTTTGAAAACATTTTATTAATGGGACAGTTTACCCAAAAAATGAAAATCTTGTCATCATTTACTCACCTTTATGTTGTTCCAAACCTGTATGAATTTCTTTTTTTCTGTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU64971 True 524 lncRNA 0.27 1 9032227 9032750

Neighbor

gene id symbol gene type direction distance location
CI01000009_09014504_09031053 RIF1 coding downstream 1174 9014227 ~ 9031053 (-)
CI01000009_08950933_08951298 NA coding downstream 79358 8950735 ~ 8952869 (-)
CI01000009_08930289_08935481 TSN coding downstream 96437 8929920 ~ 8935790 (-)
CI01000009_08882412_08884827 EAF2 coding downstream 146854 8881516 ~ 8885373 (-)
CI01000009_08870258_08879256 NA coding downstream 152971 8870199 ~ 8879256 (-)
CI01000009_09049178_09088498 ITGB5 coding upstream 15932 9048682 ~ 9088498 (-)
CI01000009_09089882_09100384 NA coding upstream 56821 9089571 ~ 9100886 (-)
CI01000009_09103888_09112675 ETV5A, ETV5 coding upstream 71040 9103790 ~ 9112675 (-)
CI01000009_09125671_09199937 DGKG coding upstream 92921 9125671 ~ 9199937 (-)
CI01000009_09263668_09270542 CRYGS4, CRYGS3 coding upstream 230875 9263625 ~ 9272243 (-)
G57053 NA non-coding downstream 83046 8948856 ~ 8949181 (-)
G56999 NA non-coding downstream 107399 8924587 ~ 8924828 (-)
G56997 NA non-coding downstream 109261 8922694 ~ 8922966 (-)
G56988 NA non-coding downstream 135853 8896152 ~ 8896374 (-)
G56986 NA non-coding downstream 146521 8885424 ~ 8885706 (-)
G57044 NA non-coding upstream 85665 9118415 ~ 9168730 (-)
G57068 NA non-coding upstream 227511 9260261 ~ 9260479 (-)
G57077 NA non-coding upstream 363545 9396295 ~ 9396901 (-)
G57020 NA non-coding upstream 407495 9440245 ~ 9447216 (-)
G57097 NA non-coding upstream 427107 9459857 ~ 9460086 (-)
CI01000009_08858198_08860555 NA other downstream 171664 8856310 ~ 8860563 (-)
G55814 NA other downstream 604215 8425821 ~ 8428012 (-)
G53515 NA other downstream 3526979 5502395 ~ 5505248 (-)
G52828 NA other downstream 4800758 4217420 ~ 4231469 (-)
CI01000009_03261739_03262843 NA other downstream 5770270 3261038 ~ 3262843 (-)
G59097 NA other upstream 3255467 12288217 ~ 12289518 (-)
CI01000009_13975122_13976026 NA other upstream 4942638 13975099 ~ 13978614 (-)
G59490 NA other upstream 5000814 14033564 ~ 14037873 (-)
G59811 NA other upstream 5829647 14862397 ~ 14887464 (-)
G59941 NA other upstream 6099354 15132104 ~ 15132503 (-)

Expression


Co-expression Network