G57068


Basic Information

Item Value
gene id G57068
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 9260261 ~ 9260479 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU65002
AAAATACTATACATACATTTATAGGTAAAATCGAACTCCGAGCCTCCTGTATGCATTCTGTGGCCCTGTCCCAAATGGCACCCTAAACCCTCACGGTCTTCCTCTGAGTCCTCACTTTCACGACGTAATGCCGCTTTGACTGCCAGGTAAAGTCCTCTGCATAGCTCACAGTCTTGCGGGCTCAGCAGAAGTGCGCATCGAGGGCGCATAGCAGCCGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU65002 True 219 lncRNA 0.51 1 9260261 9260479

Neighbor

gene id symbol gene type direction distance location
CI01000009_09125671_09199937 DGKG coding downstream 60324 9125671 ~ 9199937 (-)
CI01000009_09103888_09112675 ETV5A, ETV5 coding downstream 147586 9103790 ~ 9112675 (-)
CI01000009_09089882_09100384 NA coding downstream 159375 9089571 ~ 9100886 (-)
CI01000009_09049178_09088498 ITGB5 coding downstream 171763 9048682 ~ 9088498 (-)
CI01000009_09031859_09038439 NA coding downstream 221517 9031725 ~ 9038744 (-)
CI01000009_09263668_09270542 CRYGS4, CRYGS3 coding upstream 3146 9263625 ~ 9272243 (-)
CI01000009_09368857_09369508 CRYGM1 coding upstream 108352 9368831 ~ 9369508 (-)
CI01000009_09373830_09374425 CRYGM6 coding upstream 113351 9373830 ~ 9374425 (-)
CI01000009_09375453_09376121 NA coding upstream 114702 9375181 ~ 9376121 (-)
CI01000009_09378166_09378781 CRYGM7 coding upstream 117631 9378110 ~ 9378781 (-)
G57044 NA non-coding downstream 91531 9118415 ~ 9168730 (-)
G57037 NA non-coding downstream 227511 9032227 ~ 9032750 (-)
G57053 NA non-coding downstream 311080 8948856 ~ 8949181 (-)
G56999 NA non-coding downstream 335433 8924587 ~ 8924828 (-)
G56997 NA non-coding downstream 337295 8922694 ~ 8922966 (-)
G57077 NA non-coding upstream 135816 9396295 ~ 9396901 (-)
G57020 NA non-coding upstream 179766 9440245 ~ 9447216 (-)
G57097 NA non-coding upstream 199378 9459857 ~ 9460086 (-)
G57106 NA non-coding upstream 214971 9475450 ~ 9475671 (-)
G57111 NA non-coding upstream 227839 9488318 ~ 9488539 (-)
CI01000009_08858198_08860555 NA other downstream 399698 8856310 ~ 8860563 (-)
G55814 NA other downstream 832249 8425821 ~ 8428012 (-)
G53515 NA other downstream 3755013 5502395 ~ 5505248 (-)
G52828 NA other downstream 5028792 4217420 ~ 4231469 (-)
CI01000009_03261739_03262843 NA other downstream 5998304 3261038 ~ 3262843 (-)
G59097 NA other upstream 3027738 12288217 ~ 12289518 (-)
CI01000009_13975122_13976026 NA other upstream 4714909 13975099 ~ 13978614 (-)
G59490 NA other upstream 4773085 14033564 ~ 14037873 (-)
G59811 NA other upstream 5601918 14862397 ~ 14887464 (-)
G59941 NA other upstream 5871625 15132104 ~ 15132503 (-)

Expression


Co-expression Network