G56243


Basic Information

Item Value
gene id G56243
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 9488185 ~ 9488544 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU64046
GTGCACTCAACTTCTTTGGTCGACCATGGCGAGGCCTGTTCTGAGTGGAACCTGTCCTGTTAAACCGCTGTATGGTCTTGGCCACCGTGCTGCAGCTCAGTTTCAGGGTCTTGGCAATCTTCTTATAGCCTATGCCATCTTTATGTAGAGCAACAATTCTTTTTTTCAGATCCTCAGAGAGTTCTTTGTCATGAAGTGCCATGTTGAACTTCCAGTGACCAGTATGAGAGAGTGAGAGCGATAACACCAAATTTAACAAACCTGCTCCCCATTCACACCTGAGACCTTGTAACACTAACGAGTCACATGACACCGGGGAGAGAAAATGGCTAATTGGGCCCAGTTTGGACATTTTCACTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU64046 True 360 lncRNA 0.46 1 9488185 9488544

Neighbor

gene id symbol gene type direction distance location
CI01000009_09435601_09439347 NA coding upstream 48824 9435601 ~ 9439361 (+)
CI01000009_09390390_09394996 UCHL3 coding upstream 92863 9390390 ~ 9395322 (+)
CI01000009_09350871_09357630 CRYGMXL1 coding upstream 130474 9349311 ~ 9357711 (+)
CI01000009_09348023_09349053 CRYGM2D18, CRYGM2D14, CRYGM2D15, CRYGM2D16, CRYGM2D17, CRYGM2D10, CRYGM2D11, CRYGM2D12, CRYGM2A, CRYGM2C, CRYGM2B, CRYGM2E, CRYGM2F, CRYGM2D21, CRYGM2D20, CRYGM2D9, CRYGM2D6, CRYGM2D7, CRYGM2D4, CRYGM2D5, CRYGM2D2, CRYGM2D3, CRYGM2D1 coding upstream 139117 9347898 ~ 9349068 (+)
CI01000009_09342330_09343084 CRYGM2A, CRYGM2C, CRYGM2B, CRYGM2E, CRYGM2D20, CRYGM2F, CRYGM2D2, CRYGM2D7, CRYGM2D18, CRYGM2D21, CRYGM2D9, CRYGM2D14, CRYGM2D15, CRYGM2D17, CRYGM2D10, CRYGM2D1, CRYGM2D12, CRYGM2D5 coding upstream 145058 9342253 ~ 9343127 (+)
CI01000009_09490460_09493598 IRG1 coding downstream 1916 9490460 ~ 9493633 (+)
CI01000009_09499329_09500173 NA coding downstream 10785 9499329 ~ 9500199 (+)
CI01000009_09542674_09559750 NA coding downstream 51668 9540212 ~ 9560037 (+)
CI01000009_09685457_09693885 AFF3 coding downstream 196913 9685457 ~ 9693888 (+)
CI01000009_09700487_09709797 MPHOSPH8 coding downstream 211943 9700487 ~ 9709983 (+)
G56242 NA non-coding upstream 1377 9486599 ~ 9486808 (+)
G56204 NA non-coding upstream 4215 9482094 ~ 9483970 (+)
G56225 NA non-coding upstream 108391 9379585 ~ 9379794 (+)
G56220 NA non-coding upstream 124641 9363315 ~ 9363544 (+)
G56183 NA non-coding upstream 228128 9259321 ~ 9260057 (+)
G56306 NA non-coding downstream 159384 9647928 ~ 9654726 (+)
G56320 NA non-coding downstream 180198 9668742 ~ 9669179 (+)
CI01000009_09866000_09866290 NA non-coding downstream 376802 9865723 ~ 9867040 (+)
G56383 NA non-coding downstream 384688 9873232 ~ 9876664 (+)
G56411 NA non-coding downstream 404289 9892833 ~ 9897455 (+)
G56100 NA other upstream 357899 9129300 ~ 9130286 (+)
G53651 NA other upstream 3239793 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 3555384 5931718 ~ 5943899 (+)
G53388 NA other upstream 3949131 5522242 ~ 5540638 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other upstream 6279201 3202207 ~ 3208984 (+)
CI01000009_09853929_09854476 SAP18 other downstream 364815 9853929 ~ 9856587 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 2272242 11761606 ~ 11766944 (+)
G57811 NA other downstream 2445398 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 2944014 12432538 ~ 12436017 (+)
G57682 NA other downstream 3336925 12825469 ~ 12892339 (+)

Expression


Co-expression Network