G57179


Basic Information

Item Value
gene id G57179
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 9766774 ~ 9769132 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU65146
GCCAATCACATGCCTTGCAACAGAAAGAAACTGTGATTTACTTCTCGCGATAGAGTCAACGTGATTCAAAACTCTTTTGCTGAAGAAAATGAAGAATTTAAACGCATTTACACTAAAGAAGAAACTTGTCCATGAAAAAGGACAAATAAAAGAAATTATCTTGCTCTATCAGAGCAAGTGAAAATTAAGTGTTTATATAGTTGATTATATATAGCAATAGAGACTCAAACATGTAAGGTTATGTAG

Function

NR:

description
PREDICTED: semaphorin-4F-like isoform X3

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU65146 True 246 lncRNA 0.32 2 9766774 9769132

Neighbor

gene id symbol gene type direction distance location
CI01000009_09756032_09759196 CX30.3 coding downstream 7578 9754836 ~ 9759196 (-)
CI01000009_09747388_09751284 NA coding downstream 14718 9746969 ~ 9752056 (-)
CI01000009_09644689_09665350 ARHGEF7, ARHGEF7A coding downstream 100944 9643316 ~ 9665830 (-)
CI01000009_09565012_09566010 SOX1A, SOX1B, SOX1 coding downstream 198767 9564446 ~ 9568007 (-)
CI01000009_09507352_09522340 REV1 coding downstream 244434 9507128 ~ 9522340 (-)
CI01000009_09787635_09787950 N6AMT2, EEF1AKMT1 coding upstream 16990 9786122 ~ 9787950 (-)
CI01000009_09791141_09791496 NA coding upstream 22009 9791141 ~ 9791878 (-)
CI01000009_09792753_09812884 XPO4 coding upstream 22917 9792049 ~ 9813334 (-)
CI01000009_09817498_09826525 NA coding upstream 48115 9817247 ~ 9826525 (-)
CI01000009_09836011_09846297 LATS2 coding upstream 65619 9834751 ~ 9848630 (-)
G57176 NA non-coding downstream 12665 9753748 ~ 9754109 (-)
G57114 NA non-coding downstream 197115 9557639 ~ 9569659 (-)
G57111 NA non-coding downstream 278235 9488318 ~ 9488539 (-)
G57106 NA non-coding downstream 291103 9475450 ~ 9475671 (-)
G57097 NA non-coding downstream 306688 9459857 ~ 9460086 (-)
G57180 NA non-coding upstream 2587 9771719 ~ 9772508 (-)
G57042 NA non-coding upstream 104206 9873338 ~ 9875717 (-)
CI01000009_09908895_09911939 HAO2, HAOX2 non-coding upstream 139668 9908583 ~ 9912038 (-)
G57189 NA non-coding upstream 146056 9915188 ~ 9915459 (-)
G57210 NA non-coding upstream 195198 9964330 ~ 9964556 (-)
CI01000009_08858198_08860555 NA other downstream 906211 8856310 ~ 8860563 (-)
G55814 NA other downstream 1338762 8425821 ~ 8428012 (-)
G53515 NA other downstream 4261526 5502395 ~ 5505248 (-)
G52828 NA other downstream 5535305 4217420 ~ 4231469 (-)
CI01000009_03261739_03262843 NA other downstream 6504817 3261038 ~ 3262843 (-)
G59097 NA other upstream 2519085 12288217 ~ 12289518 (-)
CI01000009_13975122_13976026 NA other upstream 4206256 13975099 ~ 13978614 (-)
G59490 NA other upstream 4264432 14033564 ~ 14037873 (-)
G59811 NA other upstream 5093265 14862397 ~ 14887464 (-)
G59941 NA other upstream 5362972 15132104 ~ 15132503 (-)

Expression


Co-expression Network