G56417


Basic Information

Item Value
gene id G56417
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 9916869 ~ 9917173 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU64249
GTTAGTTCTAAATACAGCTTTTGGTTTTGGCATCCGCATCTTGATTAGGTGTTTCCGGCAGATGTGCGCTCAATAATATATCTCTCGTGTTGTTGTGTTAGCAAACTGCTTGTCACTTACCCCCTAAATATGTTCATATTTTTTGACACTCCAATTCTGCATGTGTATGACGTTCACAGTCTAGGAAAAAGAAAAAAAAATTACAACACAAGATCACTTCATTGTTTTGTCTATTATTTTTTCTTCATTTATCCTTTATCTTTTGTTCCATATGTTGTCATATATGTCAGACAACACAGGCCTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU64249 True 305 lncRNA 0.35 1 9916869 9917173

Neighbor

gene id symbol gene type direction distance location
CI01000009_09878612_09881564 POPDC2 coding upstream 34975 9878612 ~ 9881894 (+)
CI01000009_09866000_09866290 NA coding upstream 50475 9865723 ~ 9867040 (+)
CI01000009_09853929_09854476 SAP18 coding upstream 62367 9853929 ~ 9856587 (+)
CI01000009_09783235_09785477 IL17D coding upstream 131306 9783235 ~ 9785563 (+)
CI01000009_09770695_09782443 IFT88 coding upstream 134333 9770695 ~ 9782536 (+)
CI01000009_09952526_09962840 WARS2 coding downstream 35353 9952526 ~ 9964279 (+)
CI01000009_09967529_09989449 TBX15 coding downstream 50211 9967384 ~ 9989467 (+)
CI01000009_10103558_10119209 GDAP2 coding downstream 186385 10103558 ~ 10119220 (+)
CI01000009_10268535_10269640 NA coding downstream 351362 10268535 ~ 10269784 (+)
CI01000009_10319216_10329706 PLCD4B coding downstream 402043 10319216 ~ 10329836 (+)
G56386 NA non-coding upstream 2475 9908693 ~ 9914394 (+)
G56384 NA non-coding upstream 10093 9899687 ~ 9906776 (+)
G56412 NA non-coding upstream 18624 9897727 ~ 9898245 (+)
G56411 NA non-coding upstream 19414 9892833 ~ 9897455 (+)
G56383 NA non-coding upstream 40205 9873232 ~ 9876664 (+)
G56439 NA non-coding downstream 102933 10020106 ~ 10020343 (+)
G56349 NA non-coding downstream 134877 10052050 ~ 10135429 (+)
G56456 NA non-coding downstream 141101 10058274 ~ 10058532 (+)
G56392 NA non-coding downstream 341355 10258528 ~ 10259660 (+)
G56507 NA non-coding downstream 365900 10283073 ~ 10284524 (+)
G56100 NA other upstream 786583 9129300 ~ 9130286 (+)
G53651 NA other upstream 3668477 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 3984068 5931718 ~ 5943899 (+)
G53388 NA other upstream 4377815 5522242 ~ 5540638 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 1843613 11761606 ~ 11766944 (+)
G57811 NA other downstream 2016769 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 2515385 12432538 ~ 12436017 (+)
G57682 NA other downstream 2908296 12825469 ~ 12892339 (+)
G57691 NA other downstream 2989271 12906444 ~ 12918465 (+)

Expression


Co-expression Network