G56594


Basic Information

Item Value
gene id G56594
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 10695726 ~ 10696013 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU64453
AGTGCAAAGCGCTCTGTTTACCTTGTAAAGAGTTTGAAGGGGTCTTGCTGTGTTCTTTAAGCAAATGGAGGTTAATTTGTTTTAGTCAGGGGCTTTGATTAAGTTCTTTAGAGATGGCAGGACTGCACCGATAGCATCCTTTTTTCACAGACCTGTCTACATCCATTAAGACTAAGGACGGGGGAAAGAGTGTTGTCGTTAGAGCCCGTGAGGGATAGTCTACAGCCTCGAAAACAAGTTGAACTCAAACTATCTCAGCCTGAATCTAATAGGCCTATCCAATTTCAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU64453 True 288 lncRNA 0.43 1 10695726 10696013

Neighbor

gene id symbol gene type direction distance location
CI01000009_10644080_10691030 CPS1 coding upstream 3676 10644080 ~ 10692050 (+)
CI01000009_10583435_10617169 MAP2 coding upstream 78557 10583435 ~ 10617169 (+)
CI01000009_10555555_10560050 NA coding upstream 135328 10554350 ~ 10560398 (+)
CI01000009_10491868_10508777 NA coding upstream 186717 10491401 ~ 10509009 (+)
CI01000009_10477699_10485965 NA coding upstream 208373 10476658 ~ 10487353 (+)
CI01000009_11342784_11347580 NA coding downstream 646771 11342784 ~ 11348827 (+)
CI01000009_11434018_11455253 NA coding downstream 737779 11433792 ~ 11455635 (+)
CI01000009_11493236_11526914 VWC2L coding downstream 797223 11493236 ~ 11526914 (+)
CI01000009_11669960_11702667 HIBCH coding downstream 973947 11669960 ~ 11703539 (+)
CI01000009_11711277_11714191 MSTN, GDF-8, MSTNB coding downstream 1015147 11711160 ~ 11714694 (+)
G56548 NA non-coding upstream 57274 10631098 ~ 10638452 (+)
G56567 NA non-coding upstream 162001 10518816 ~ 10533725 (+)
G56579 NA non-coding upstream 183086 10512413 ~ 10512640 (+)
G56564 NA non-coding upstream 342042 10352929 ~ 10353684 (+)
G56393 NA non-coding upstream 391241 10303482 ~ 10304485 (+)
G56628 NA non-coding downstream 19597 10715610 ~ 10715888 (+)
G56633 NA non-coding downstream 25881 10721894 ~ 10722336 (+)
G56695 NA non-coding downstream 134979 10830992 ~ 10860154 (+)
G56725 NA non-coding downstream 190426 10886439 ~ 10926871 (+)
G56744 NA non-coding downstream 223847 10919860 ~ 10932759 (+)
CI01000009_09853929_09854476 SAP18 other upstream 839139 9853929 ~ 9856587 (+)
G56100 NA other upstream 1565440 9129300 ~ 9130286 (+)
G53651 NA other upstream 4447334 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 4762925 5931718 ~ 5943899 (+)
G53388 NA other upstream 5156672 5522242 ~ 5540638 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 1064773 11761606 ~ 11766944 (+)
G57811 NA other downstream 1237929 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 1736545 12432538 ~ 12436017 (+)
G57682 NA other downstream 2129456 12825469 ~ 12892339 (+)
G57691 NA other downstream 2210431 12906444 ~ 12918465 (+)

Expression


Co-expression Network