G22576


Basic Information

Item Value
gene id G22576
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035899.1
NCBI id CM008302.1
chromosome length 74127438
location 30304295 ~ 30304616 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU30449
gcgcgggagttcactgcagtgttatctacacagtctgtattgctgtaggctttggatggagttgaggatggagagttttatcttgttcagaggaactaaacgcgttgcagtgaaagaagacgatatgacaacagaaaaaatcggcaggatctttcaggtgaaactctccatcctcaactccatccaaagcctacagcaatacagactgtgtagataacactgcagtgaactcccgcgcaacagaaacccaccaagaataaacaaatcagtaacttccggggcacacaaatgggtcaagttcaaaatcaaaatcaaattcggc

Function

GO:

id name namespace
GO:0010035 response to inorganic substance biological_process
GO:0010038 response to metal ion biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU30449 True 322 lncRNA 0.44 1 30304295 30304616

Neighbor

gene id symbol gene type direction distance location
LOC103028785 LOC103028785,LOC108412595,LOC105899448,LOC107695994,LOC107582101 coding upstream 8377 30283641 ~ 30295918 (+)
LOC103041619 NA coding upstream 54547 30227545 ~ 30249748 (+)
LOC103043161 NA coding upstream 124488 30174820 ~ 30179807 (+)
LOC103039153 LOC108426583 coding upstream 142468 30145146 ~ 30161827 (+)
dcaf11 dcaf11,LOC107691410 coding upstream 161132 30131539 ~ 30143163 (+)
LOC103040669 LOC108411512,LOC102303064,LOC101467994 coding downstream 70959 30375575 ~ 30393774 (+)
ylpm1 ylpm1,LOC108411503,LOC107729078,LOC107685771 coding downstream 109499 30414115 ~ 30433290 (+)
LOC103026930 LOC103026930,LOC108411508,LOC105017614,LOC107714796,LOC107670243,LOC107565462,LOC107550532,LOC107676708 coding downstream 145486 30450102 ~ 30480340 (+)
LOC103029213 NA coding downstream 767531 31072147 ~ 31076057 (+)
LOC103029526 NA coding downstream 778889 31083505 ~ 31089458 (+)
G22558 NA non-coding upstream 39005 30265025 ~ 30265290 (+)
G22556 NA non-coding upstream 39649 30264370 ~ 30264646 (+)
G22456 NA non-coding upstream 298801 30000115 ~ 30005494 (+)
G22445 NA non-coding upstream 440230 29862505 ~ 29864065 (+)
G22430 NA non-coding upstream 715025 29589046 ~ 29589270 (+)
G22614 NA non-coding downstream 135889 30440505 ~ 30446957 (+)
LOC111195805 NA non-coding downstream 211579 30516195 ~ 30519886 (+)
G22626 NA non-coding downstream 229712 30534328 ~ 30535041 (+)
G22635 NA non-coding downstream 265811 30570427 ~ 30583460 (+)
G22636 NA non-coding downstream 281849 30586465 ~ 30586802 (+)
LOC111195794 LOC107569315,LOC107712034,LOC107751710 other upstream 40445 30259308 ~ 30263850 (+)
LOC103034207 ube2w,LOC107585923,LOC103354920 other upstream 1122164 29171008 ~ 29182131 (+)
pabpn1 pabpn1,LOC107596039 other upstream 1136382 29152052 ~ 29167913 (+)
G22276 NA other upstream 1315464 28988568 ~ 28988831 (+)
LOC111192074 LOC108249465 other upstream 1656107 28645061 ~ 28648188 (+)
LOC103026436 LOC108411506,LOC103368653 other downstream 144748 30449364 ~ 30512826 (+)
G22834 NA other downstream 1189729 31494345 ~ 31494898 (+)
G23086 cpsf2,LOC107704064,LOC107548411,LOC107559080,LOC107669458 other downstream 2517728 32822344 ~ 32826939 (+)
LOC103042732 NA other downstream 2532436 32837052 ~ 32841346 (+)
LOC103037425 LOC108426312 other downstream 2772008 33076624 ~ 33081862 (+)

Expression


Co-expression Network