G57665


Basic Information

Item Value
gene id G57665
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 11664022 ~ 11666325 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU65693
CCAGCATTACTGACGTGGCTGTTAAGTTGTTTAGAAGGACAGGGGCCAAAATAGAGGCATGCCCCTGAGCAGATAAACAGGTGACATTCAATGCTCTGGTCTCCTCATAACCCCAAAACCAACCTCTGTAATAGCCTTGTTTGTCTTTTGAGTACATCAGTCTTTCAATGCACGGTCGTTCATCCACCTTCTCCTCCCATTTCCCATCTGTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU65693 True 213 lncRNA 0.47 3 11664022 11666325

Neighbor

gene id symbol gene type direction distance location
CI01000009_11493236_11526914 VWC2L coding upstream 137108 11493236 ~ 11526914 (+)
CI01000009_11434018_11455253 NA coding upstream 208387 11433792 ~ 11455635 (+)
CI01000009_11342784_11347580 NA coding upstream 315195 11342784 ~ 11348827 (+)
CI01000009_10644080_10691030 CPS1 coding upstream 971972 10644080 ~ 10692050 (+)
CI01000009_10583435_10617169 MAP2 coding upstream 1046853 10583435 ~ 10617169 (+)
CI01000009_11669960_11702667 HIBCH coding downstream 3635 11669960 ~ 11703539 (+)
CI01000009_11711277_11714191 MSTN, GDF-8, MSTNB coding downstream 44835 11711160 ~ 11714694 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 coding downstream 95281 11761606 ~ 11766944 (+)
CI01000009_11769442_11773619 OSGEPL1 coding downstream 103117 11769442 ~ 11773619 (+)
CI01000009_11789703_11791511 NA coding downstream 123378 11789703 ~ 11791736 (+)
G57654 NA non-coding upstream 8658 11620460 ~ 11655364 (+)
G57606 NA non-coding upstream 131242 11530797 ~ 11532780 (+)
G57626 NA non-coding upstream 150818 11512902 ~ 11513204 (+)
G57618 NA non-coding upstream 196498 11467265 ~ 11467524 (+)
G57616 NA non-coding upstream 199164 11464649 ~ 11464858 (+)
G57772 NA non-coding downstream 80052 11746377 ~ 11757663 (+)
G57786 NA non-coding downstream 111514 11777839 ~ 11778105 (+)
G57787 NA non-coding downstream 114004 11780329 ~ 11780567 (+)
G57789 NA non-coding downstream 120579 11786904 ~ 11787326 (+)
G57790 NA non-coding downstream 121251 11787576 ~ 11787784 (+)
CI01000009_09853929_09854476 SAP18 other upstream 1807435 9853929 ~ 9856587 (+)
G56100 NA other upstream 2533736 9129300 ~ 9130286 (+)
G53651 NA other upstream 5415630 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 5731221 5931718 ~ 5943899 (+)
G53388 NA other upstream 6124968 5522242 ~ 5540638 (+)
G57811 NA other downstream 267617 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 766233 12432538 ~ 12436017 (+)
G57682 NA other downstream 1159144 12825469 ~ 12892339 (+)
G57691 NA other downstream 1240119 12906444 ~ 12918465 (+)

Expression


Co-expression Network