G59055


Basic Information

Item Value
gene id G59055
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 12105799 ~ 12106029 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU67234
TCAGACTATAGAGCAGCTCTTTCCCTGAGCAGCACTCAGAGATGAGCACCAGGTAGCGTGGGGTGACGTAAGCCTCATGCAGAGCCATGACCTTCTCGTGGTGGAGGGATTTCAGTATGTCATACTCCTGTAACACGGCCTGCTTGCTTTCAGGCTCATACGGCACAATCTTGGCCATGTACAGGTTACCGGTGGCATTTTCCCGACACTCTCTGATCACACCAAAACGAC

Function

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU67234 True 231 lncRNA 0.52 1 12105799 12106029

Neighbor

gene id symbol gene type direction distance location
CI01000009_12007202_12021667 MFSD6 coding downstream 83762 12006768 ~ 12022037 (-)
CI01000009_11947288_11963040 NAB1, NAB1B coding downstream 142759 11946457 ~ 11963040 (-)
CI01000009_11892743_11932618 GLS, GLSA, GLSB coding downstream 173181 11892689 ~ 11932618 (-)
CI01000009_11885290_11889329 NA coding downstream 215943 11884974 ~ 11889856 (-)
CI01000009_11812069_11833136 WDR75 coding downstream 272663 11811892 ~ 11833136 (-)
CI01000009_12152712_12167719 OBSL1B coding upstream 46436 12152465 ~ 12167719 (-)
CI01000009_12167744_12175422 NA coding upstream 61715 12167744 ~ 12175422 (-)
CI01000009_12176488_12184112 OBSL1 coding upstream 70125 12176154 ~ 12185660 (-)
CI01000009_12304891_12322499 NA coding upstream 198660 12304689 ~ 12322924 (-)
CI01000009_12486758_12498650 CALCRLA, CALCRL coding upstream 379597 12485626 ~ 12498650 (-)
G59054 NA non-coding downstream 821 12104760 ~ 12104978 (-)
G59014 NA non-coding downstream 32259 12050978 ~ 12073540 (-)
G59011 NA non-coding downstream 112460 11993061 ~ 11993339 (-)
G58996 NA non-coding downstream 169162 11936337 ~ 11936637 (-)
G58885 NA non-coding downstream 294956 11803538 ~ 11810843 (-)
G59056 NA non-coding upstream 407 12106436 ~ 12107613 (-)
G59057 NA non-coding upstream 1664 12107693 ~ 12108052 (-)
G59058 NA non-coding upstream 3033 12109062 ~ 12110518 (-)
G59059 NA non-coding upstream 4706 12110735 ~ 12111782 (-)
G59060 NA non-coding upstream 6561 12112590 ~ 12112848 (-)
CI01000009_08858198_08860555 NA other downstream 3245236 8856310 ~ 8860563 (-)
G55814 NA other downstream 3677787 8425821 ~ 8428012 (-)
G53515 NA other downstream 6600551 5502395 ~ 5505248 (-)
G52828 NA other downstream 7874330 4217420 ~ 4231469 (-)
CI01000009_03261739_03262843 NA other downstream 8843842 3261038 ~ 3262843 (-)
G59097 NA other upstream 182188 12288217 ~ 12289518 (-)
CI01000009_13975122_13976026 NA other upstream 1869359 13975099 ~ 13978614 (-)
G59490 NA other upstream 1927535 14033564 ~ 14037873 (-)
G59811 NA other upstream 2756368 14862397 ~ 14887464 (-)
G59941 NA other upstream 3026075 15132104 ~ 15132503 (-)

Expression


Co-expression Network