G26158 (cdc42bpb,LOC106607646)


Basic Information

Item Value
gene id G26158
gene name cdc42bpb,LOC106607646
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035899.1
NCBI id CM008302.1
chromosome length 74127438
location 44441661 ~ 44444962 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU35199
CTCAAAGGAGATGTTGGCAGCCTTGACCTTGCGCAGCTCCTCCTGGACCAGCTGTTTGGCTCTGATCTCAGCATCCAAAGCTGACTGCAACTCCAAACGAGCAGACATGTCCAACTTCTGACTGCGACGCACCTTCCACAAGGGATCCAGGTGTCTGGATCCAAGGCTGGAACTGCGCAGTGACTCCAACTCCTCAGTCATCTTAGAGGCCAAAGCCTGCAGGTAGCCACGGGCATCCTTCTCATCACTCACCCACTGAATAATCTCAGCAATCTGTGCCTCCCAGTGTGCAACGCTCTCTTTCTTAGACGCCAGGTCCTGTAGCTCATCCTCCAGCTGTCTGTTCTGGGCTGTTAGTTTGTCCACAAATGTGCAAAGCCTGTCAGTTTCGGAGGTTAGTTTGCGGTTCTCCTCGGTCAGCAGGTTACGCTCACGCTCATATTTATCCTTCAAAGTACCCACTGCCTCATCCATCTCCGTTTGC

Function

symbol description
cdc42bpb Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in actomyosin structure organization and peptidyl-threonine phosphorylation. Predicted to act upstream of or within several processes, including actin cytoskeleton organization; intracellular signal transduction; and protein phosphorylation. Predicted to be located in lamellipodium. Predicted to be active in cytoplasm and cytoskeleton. Orthologous to human CDC42BPB (CDC42 binding protein kinase beta).

NR:

description
PREDICTED: serine/threonine-protein kinase MRCK beta

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU35199 True 484 lncRNA 0.53 4 44441661 44444962

Neighbor

gene id symbol gene type direction distance location
LOC103042571 stmn4,LOC108439832,LOC108257558 coding downstream 73821 44360099 ~ 44367840 (-)
LOC103041948 LOC108439850 coding downstream 117204 44321703 ~ 44324457 (-)
LOC103028959 NA coding downstream 123824 44311254 ~ 44317837 (-)
LOC103040630 znf395 coding downstream 132963 44298947 ~ 44308698 (-)
LOC103039281 si:ch211-63o20.7,LOC108439852,LOC108258100,LOC107732427,LOC107726431,LOC107698369 coding downstream 178468 44256451 ~ 44263193 (-)
LOC103028241 runx2b,runx2,LOC103028241,LOC108410521,LOC108258149,LOC107678859,LOC107726745 coding upstream 80924 44525886 ~ 44575275 (-)
mut mut,LOC107726757,LOC107697172,LOC107726528 coding upstream 292205 44737167 ~ 44760205 (-)
LOC103027014 mfsd2b,si:dkeyp-115a10.3,LOC107750078,LOC107697177 coding upstream 363864 44808826 ~ 44851093 (-)
klhl29 klhl29,LOC107667613,LOC107742703,LOC107697176 coding upstream 538282 44983244 ~ 45315255 (-)
trib2 trib2,LOC107742704,LOC107667617,LOC107717709,LOC107697179 coding upstream 913948 45358910 ~ 45365846 (-)
G26154 NA non-coding downstream 64134 44377323 ~ 44377527 (-)
G26084 elp3,LOC107732362,LOC107698368,LOC107553498,LOC107696156,LOC107599080 non-coding downstream 217388 44221013 ~ 44224273 (-)
G26083 NA non-coding downstream 243183 44195249 ~ 44198478 (-)
G26038 NA non-coding downstream 385362 44054940 ~ 44056299 (-)
G26032 NA non-coding downstream 403824 44037302 ~ 44037837 (-)
LOC111197214 NA non-coding upstream 169248 44614210 ~ 44615581 (-)
G26238 NA non-coding upstream 238226 44683188 ~ 44688822 (-)
G26240 NA non-coding upstream 253449 44698411 ~ 44698915 (-)
G26278 NA non-coding upstream 408106 44853068 ~ 44853571 (-)
G26290 NA non-coding upstream 417222 44862184 ~ 44865066 (-)
cbr4 cbr4,LOC107597475,LOC107665353 other downstream 541901 43890629 ~ 43899760 (-)
G25967 mcm3l,LOC108416133,LOC108258154,LOC107697457 other downstream 762799 43675025 ~ 43678862 (-)
LOC103027084 LOC108416115,LOC103358919 other downstream 924504 43495419 ~ 43517157 (-)
G25785 NA other downstream 1330260 43098822 ~ 43111401 (-)
G25678 NA other downstream 1723272 42717666 ~ 42718389 (-)
fkbp1b fkbp1b other upstream 324302 44769264 ~ 44799505 (-)
ubxn2a ubxn2a,LOC107603085,LOC107750080,LOC107697178 other upstream 411137 44856099 ~ 44870690 (-)
G26295 atad2b,LOC107697175,LOC107603081 other upstream 437816 44882778 ~ 44885801 (-)
G26388 NA other upstream 991147 45436109 ~ 45437585 (-)
G26588 NA other upstream 1490191 45935153 ~ 45935622 (-)

Expression


Co-expression Network