G57724


Basic Information

Item Value
gene id G57724
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 12167531 ~ 12168221 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU65755
AACCGTGTACATACATGTTTTTCATTGTGGTAAACAAGTAGTACCTTGTACAGTAACAGTGAAGACAACTTTATCATCTTGTGCATCACAAATGTACTCTCCTGAGTCCATCAACTCAGCACTCAGAACAATCAGAGATCTGAATGCCCCTTCCTCTTCACAGATGAAATGCTCCTTTCCCTCAATCTTCTCATTGTCTTTAAGCCAACTGACCACCCCATTTGCTCTTGAGATCTCACATTTTAAGACAATCGCATCAGATACTACAAACTGGCGTTTCGTTTCTATGTCAGCTTTCCGCAGAATTTTCAGTGGTGGATCTTTGATTTTCACTAGGAAGTCCATTACATCATCTCTGGCATCACAGACATATTGCCCTGCATCATCCAAAGCTGCGGAGTGAATGGTTAACTGTCGACTTGTGCCATCCTCTGTGATAGTAATGTTGATGTTCTCCTCAATCTCTTCTCCATCCTTCTTCCAGCTAACTTCAGCATTTGGTCGAGACACTTCACACTCAAGGACCACAATGTCTCCAACAAGTTTCTCTACTGCATAGGTTGTTTTCCTTGGCCGAATAAACCTAACTGGTGGCTCTG

Function

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU65755 True 599 lncRNA 0.43 2 12167531 12168221

Neighbor

gene id symbol gene type direction distance location
CI01000009_12130688_12146560 CTDS1, CTDSP1 coding upstream 20589 12130688 ~ 12146942 (+)
CI01000009_12050866_12109305 SPEG coding upstream 57433 12050773 ~ 12110098 (+)
CI01000009_12028975_12032758 NA coding upstream 134494 12028495 ~ 12033037 (+)
CI01000009_12022660_12022944 NA coding upstream 144143 12022560 ~ 12023388 (+)
CI01000009_11993879_12004644 NEMP2 coding upstream 162766 11993644 ~ 12004765 (+)
CI01000009_12198114_12221988 NA coding downstream 28478 12196699 ~ 12221993 (+)
CI01000009_12249416_12290497 COL18A1 coding downstream 80742 12248963 ~ 12290598 (+)
CI01000009_12351325_12366549 PCBP3 coding downstream 183104 12351325 ~ 12366597 (+)
CI01000009_12387605_12388405 LRRC3 coding downstream 217001 12385222 ~ 12390665 (+)
CI01000009_12432736_12435509 NA coding downstream 264317 12432538 ~ 12436017 (+)
G57813 NA non-coding upstream 228892 11938378 ~ 11938639 (+)
G57792 NA non-coding upstream 332571 11834738 ~ 11834960 (+)
G57719 NA non-coding upstream 345000 11815069 ~ 11822531 (+)
G57790 NA non-coding upstream 379747 11787576 ~ 11787784 (+)
G57789 NA non-coding upstream 380205 11786904 ~ 11787326 (+)
G57737 NA non-coding downstream 3142 12171363 ~ 12172140 (+)
G57850 NA non-coding downstream 20324 12188545 ~ 12188820 (+)
G57704 NA non-coding downstream 137418 12305639 ~ 12372174 (+)
G57733 NA non-coding downstream 157902 12326123 ~ 12350280 (+)
G57811 NA other upstream 232280 11933942 ~ 11935251 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other upstream 400587 11761606 ~ 11766944 (+)
CI01000009_09853929_09854476 SAP18 other upstream 2310944 9853929 ~ 9856587 (+)
G56100 NA other upstream 3037245 9129300 ~ 9130286 (+)
G53651 NA other upstream 5919139 6245564 ~ 6248392 (+)
G57682 NA other downstream 657248 12825469 ~ 12892339 (+)
G57691 NA other downstream 738223 12906444 ~ 12918465 (+)
G57701 NA other downstream 838422 13006643 ~ 13023138 (+)
G58028 NA other downstream 972157 13140378 ~ 13143608 (+)

Expression


Co-expression Network