G59224



Basic Information


Item Value
gene id G59224
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 12432563 ~ 12433051 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU67429
CTGAAGTGTCCACGGTTTTGATCCAATTTCTGAGTTCAGGAGAAATTTCATTCACATCATCATCTTTCAGCAAAATCAGAAAATCTCGACACACATTTTCACCTTTTCCAAGGATGATGTCCAAAAGTTTAACAACCCTATCTCTGGGAACTGTCACAGACTTCAGTTCATCGTACTCCGGCATTGTTATAAGTTCTTTAGCTTGAACATGTTGCAAAATATGCATTAAATCCACACTAAGCCATTTGATGAGCTTAGGTTTGTTATTCAAAATGACTTTATTCATTTTCTACAACAGGTTTACGCCACAACCTTGTATTGACTTAATAAATACCGTAGACAGACTTTACTTTCGAT
>TU67430
CTAGTATTTGGACACCCTTCAGCAAAAATGGGCCACTAGTTTCACTTTATGAACTGGTTTTTAAGCGATATTAAATCATAAATGATAAGTGCACAATTATATGTGCACGTTGTATTTTGCAAAGAAACATACCTGAAGTGTCCACGGTTTTGATCCAATTTCTGAGTTCAGGAGAAATTTCATTCACATCATCATCTTTCAGCAAAATCAGAAAATCTCGACACACATTTTCACCTTTTCCAAGGATGATGTCCAAAAGTTTAACAACCCTATCTCTGGGAACTGTCACAGACTTCAGTTCATCGTACTCCGGCATTGTTATAAGTTCTTTAGCTTGAACATGTTGCAAAATATGCATTAAATCCACACTAAGCCATTTGATGAGCTTAGGTTTGTTATTCAAAATGACTTTATTCATTTTCTACAACAGGTTTACGCCACAACCTTGTATTGACTTAATAAATACCGTAGACAGACTTTACTTTCGAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU67429 False 357 lncRNA 0.36 1 12432563 12432919
TU67430 True 489 lncRNA 0.35 1 12432563 12433051

Neighbor


gene id symbol gene type direction distance location
CI01000009_12304891_12322499 NA coding downstream 109639 12304689 ~ 12322924 (-)
CI01000009_12176488_12184112 OBSL1 coding downstream 246903 12176154 ~ 12185660 (-)
CI01000009_12167744_12175422 NA coding downstream 257141 12167744 ~ 12175422 (-)
CI01000009_12152712_12167719 OBSL1B coding downstream 264844 12152465 ~ 12167719 (-)
CI01000009_12007202_12021667 MFSD6 coding downstream 410526 12006768 ~ 12022037 (-)
CI01000009_12486758_12498650 CALCRLA, CALCRL coding upstream 52575 12485626 ~ 12498650 (-)
CI01000009_12531562_12540003 NA coding upstream 98074 12531125 ~ 12540373 (-)
CI01000009_12643324_12643737 NA coding upstream 210210 12643261 ~ 12643988 (-)
CI01000009_12659018_12693857 COL5A2 coding upstream 225312 12658363 ~ 12694684 (-)
CI01000009_12711691_12713525 FKBP7 coding upstream 278530 12711581 ~ 12713525 (-)
G59220 NA non-coding downstream 4199 12428137 ~ 12428364 (-)
G59213 NA non-coding downstream 21421 12410917 ~ 12411142 (-)
G59209 NA non-coding downstream 25460 12406796 ~ 12407103 (-)
G59206 NA non-coding downstream 30642 12401604 ~ 12401921 (-)
G59200 NA non-coding downstream 39031 12393247 ~ 12393532 (-)
G59230 NA non-coding upstream 13908 12446959 ~ 12447178 (-)
G59245 NA non-coding upstream 36985 12470036 ~ 12470265 (-)
G59255 NA non-coding upstream 108487 12541538 ~ 12542357 (-)
G59295 NA non-coding upstream 161680 12594731 ~ 12597373 (-)
G59300 NA non-coding upstream 186338 12619389 ~ 12619594 (-)
G59097 NA other downstream 143045 12288217 ~ 12289518 (-)
CI01000009_08858198_08860555 NA other downstream 3572000 8856310 ~ 8860563 (-)
G55814 NA other downstream 4004551 8425821 ~ 8428012 (-)
G53515 NA other downstream 6927315 5502395 ~ 5505248 (-)
G52828 NA other downstream 8201094 4217420 ~ 4231469 (-)
CI01000009_13975122_13976026 NA other upstream 1542337 13975099 ~ 13978614 (-)
G59490 NA other upstream 1600513 14033564 ~ 14037873 (-)
G59811 NA other upstream 2429346 14862397 ~ 14887464 (-)
G59941 NA other upstream 2699053 15132104 ~ 15132503 (-)
CI01000009_15318811_15390382 TNS1 other upstream 2943209 15318811 ~ 15390382 (-)

Expression



Co-expression Network