G31073 (prrc2c,LOC107697494)



Basic Information


Item Value
gene id G31073
gene name prrc2c,LOC107697494
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035899.1
NCBI id CM008302.1
chromosome length 74127438
location 65924231 ~ 65924697 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU41729
CCAGGCTCTCTTCCATCTTGCTTCCTCCGGTGGGGACAGTGTCCGCCAGTGATGAGGATGGGGTAGTGTAGTCAGTTACAGATTCCTTGGAGCTGCTTGAGTATTCTGCTGAGGGGACCGTGATCATGCCCTCAATATCGCCTCCAAGTTCAGGAACTTTGTCTTTAACAGGTGAGCTAGATTCTCTATCCCGGCTGCTTCCAGGACCACCCTTCTCCAAAACCTCTCCATCTGACTGGCGGCCATCTTTGGCTTTCCGGTTCTTCAGCGAACGCTCCTTACCAATTGGGCCTGGCTTGTACTCCTTTTGCTCAGGAGCAGCAATGTCAG

Function


symbol description
prrc2c Predicted to be involved in cell differentiation. Orthologous to human PRRC2C (proline rich coiled-coil 2C).

NR:

description
PREDICTED: protein PRRC2C isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU41729 True 330 lncRNA 0.53 2 65924231 65924697

Neighbor


gene id symbol gene type direction distance location
LOC103026271 prdx6,LOC107712864 coding downstream 77051 65838880 ~ 65847180 (-)
jun jun coding downstream 315457 65606592 ~ 65608774 (-)
LOC103027150 LOC108415562 coding downstream 322692 65598312 ~ 65601539 (-)
LOC103027761 NA coding downstream 326772 65592679 ~ 65597459 (-)
LOC103027441 NA coding downstream 337662 65582983 ~ 65586569 (-)
myoc myoc coding upstream 6626 65931323 ~ 65941098 (-)
vamp4 vamp4 coding upstream 22937 65947634 ~ 65965285 (-)
itpa itpa coding upstream 61828 65986525 ~ 65989450 (-)
nt5e nt5e,LOC107562347,LOC107660511,LOC107680304,LOC107554926 coding upstream 466940 66391637 ~ 66430046 (-)
mei4 NA coding upstream 623293 66547990 ~ 66674798 (-)
G31070 NA non-coding downstream 864 65918392 ~ 65923367 (-)
G31053 NA non-coding downstream 38064 65885468 ~ 65886167 (-)
G31054 NA non-coding downstream 40618 65883267 ~ 65883613 (-)
G31052 NA non-coding downstream 43524 65878096 ~ 65880707 (-)
G31051 NA non-coding downstream 48805 65875187 ~ 65875426 (-)
G31102 NA non-coding upstream 80196 66004893 ~ 66005868 (-)
G31108 NA non-coding upstream 99518 66024215 ~ 66069347 (-)
G31109 NA non-coding upstream 101353 66026050 ~ 66038372 (-)
G31118 NA non-coding upstream 148636 66073333 ~ 66076356 (-)
G31120 NA non-coding upstream 155247 66079944 ~ 66080258 (-)
trnad-guc_8 NA other downstream 826558 65097602 ~ 65097673 (-)
trnad-guc_7 NA other downstream 831082 65093078 ~ 65093149 (-)
LOC103036530 cyp2p7,cyp2j20,LOC108415355 other downstream 1125055 64774684 ~ 64799176 (-)
scfd2 scfd2 other downstream 2160558 63528281 ~ 63763673 (-)
usp46 usp46 other downstream 2439210 63433792 ~ 63485021 (-)
LOC103031958 myo6 other upstream 937768 66862465 ~ 67044318 (-)
G31424 NA other upstream 1499175 67423872 ~ 67432424 (-)
G31437 NA other upstream 1579052 67503749 ~ 67528337 (-)
arpc5 arpc5,arpc5b,LOC103045524,LOC107599090,LOC107698380,LOC107732423,LOC104921830 other upstream 1930909 67855606 ~ 67885433 (-)
LOC103046133 LOC108439589 other upstream 2007863 67932560 ~ 67940713 (-)

Expression



Co-expression Network