G32327


Basic Information

Item Value
gene id G32327
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035899.1
NCBI id CM008302.1
chromosome length 74127438
location 71025689 ~ 71028881 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU43405
tacactacattgctacacactctacactacactgctacacactctacactacactgctgcacactctactctacaccgctgcacactctacactacactgctacacactctacactatactgctacacactctacactacattgctacacactctacactacattgctacacactctacactacattgctacacactctacactacactgctacacactctacactacactgctacacac
>TU43407
ctacactacactgctacacactctacactacattgctacacaatctacactacactgctacacactctacactacactgctacacactctacactatactgctacacactctacactacattgctacacactctacactacattgctacacactctacactacattgctacacactctacactacactgctacacactctacactacactgctacacac

Function

GO:

id name namespace
GO:0045861 negative regulation of proteolysis biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU43405 True 240 lncRNA 0.47 2 71025689 71027654
TU43407 False 219 lncRNA 0.50 2 71025689 71028881

Neighbor

gene id symbol gene type direction distance location
tshr tshr coding downstream 110039 70870863 ~ 70915650 (-)
brox brox,LOC107732498,LOC107710643,LOC107568230 coding downstream 158027 70856750 ~ 70867662 (-)
c3h8orf82 cunh8orf82,LOC103038903,LOC107704038,LOC107567028 coding downstream 382364 70640472 ~ 70643325 (-)
naprt LOC107728101,LOC107746003 coding downstream 385763 70622015 ~ 70639926 (-)
rhpn1 rhpn1,LOC107704026 coding downstream 405802 70600828 ~ 70619887 (-)
snw1 snw1,LOC107681047,LOC106608236 coding upstream 25564 71054445 ~ 71060960 (-)
LOC103038639 ism2 coding upstream 48229 71077110 ~ 71086957 (-)
trnat-ugu_81 NA coding upstream 67750 71096631 ~ 71096703 (-)
ccnk ccnk,LOC107560198,LOC107555300,LOC107678663 coding upstream 70721 71099602 ~ 71105819 (-)
pigc pigc,LOC107581520,LOC107697628,LOC107712841,LOC107597814 coding upstream 145348 71174229 ~ 71177206 (-)
G32316 NA non-coding downstream 52132 70965016 ~ 70973557 (-)
G32285 NA non-coding downstream 207986 70817272 ~ 70817703 (-)
G32279 NA non-coding downstream 231825 70793302 ~ 70793864 (-)
G32275 NA non-coding downstream 247839 70777149 ~ 70777850 (-)
G32267 NA non-coding downstream 274871 70748226 ~ 70750818 (-)
G32344 NA non-coding upstream 61620 71090501 ~ 71093213 (-)
G32346 NA non-coding upstream 132421 71161302 ~ 71163064 (-)
G32375 NA non-coding upstream 225459 71254340 ~ 71257919 (-)
G32386 NA non-coding upstream 232114 71260995 ~ 71289235 (-)
G32389 NA non-coding upstream 250739 71279620 ~ 71280405 (-)
sec63 sec63,LOC107726621,LOC107696131,LOC107726458 other downstream 1863785 69145308 ~ 69161904 (-)
fam84a fam84a other downstream 2196669 68825989 ~ 68829020 (-)
G31622 NA other downstream 2934108 68091220 ~ 68091581 (-)
LOC103046133 LOC108439589 other downstream 3084976 67932560 ~ 67940713 (-)
arpc5 arpc5,arpc5b,LOC103045524,LOC107599090,LOC107698380,LOC107732423,LOC104921830 other downstream 3140256 67855606 ~ 67885433 (-)
G32343 NA other upstream 59994 71088875 ~ 71089461 (-)
G32364 NA other upstream 109605 71138486 ~ 71142338 (-)
G32492 NA other upstream 941623 71970504 ~ 71982053 (-)
G32557 NA other upstream 1212649 72241530 ~ 72242270 (-)
G32611 NA other upstream 1498902 72527783 ~ 72542447 (-)

Expression


Co-expression Network