G59491


Basic Information

Item Value
gene id G59491
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 14039324 ~ 14039893 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU67749
TCCTGCCTGCTTGTCTTGCTCCAACACCAGGACTTTCTTTCCTAGTTTGGCTAAAGTTGCCGCTGCAGTCAGACCACCAATACCGCTGCCAATCACAATGACATCCAAGCTTATGGGCACTTCAAATTCATCAAATCTCTCTGGAGCACTCTGTACTTTTTCTTCTGGTCTACAACTAGTGGGCTAGGAGGACTGATAATCTCCTTGCACAGTCCACTTCTCCTTCCAAACAAATACCAGAACGTGCCACGAGCCCAGTCCACCAGCCATTCTAAGAAAAGCAGAATCCACCACATCTTTAATTGCTGGAAAAAGAGCAGTTGGTGTTTTCAGTTTCACGAGTGACTGCTGGAGATTTCACACTTTATAAGATATTAAAATCTCAAGCAGCAGCTCTTTCCAGAGACTGCAGACAACGGTTTAGTACTGGTGATTGAGTTAAGGCCCTCTTTACTAGTCTAAATTGTGGGTGGAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU67749 True 477 lncRNA 0.45 2 14039324 14039893

Neighbor

gene id symbol gene type direction distance location
CI01000009_14012800_14024940 ITGB2 coding downstream 14093 14011950 ~ 14025231 (-)
CI01000009_13990326_14004387 VIL1 coding downstream 34498 13989732 ~ 14004826 (-)
CI01000009_13983271_13988001 NA coding downstream 50976 13983208 ~ 13988348 (-)
CI01000009_13975122_13976026 NA coding downstream 62200 13975099 ~ 13978614 (-)
CI01000009_13963789_13974296 DNAJC10 coding downstream 65028 13962949 ~ 13974296 (-)
CI01000009_14052206_14053489 NA coding upstream 12076 14051969 ~ 14053953 (-)
CI01000009_14201347_14205288 NA coding upstream 161222 14201115 ~ 14205887 (-)
CI01000009_14248805_14255014 NA coding upstream 207750 14247643 ~ 14255775 (-)
CI01000009_14342067_14344332 NA coding upstream 302094 14341987 ~ 14344934 (-)
CI01000009_14476688_14573629 HDAC4 coding upstream 435831 14475724 ~ 14573629 (-)
G59488 NA non-coding downstream 98696 13939445 ~ 13940628 (-)
G59489 NA non-coding downstream 107643 13883972 ~ 13931681 (-)
G59470 NA non-coding downstream 174721 13826486 ~ 13864603 (-)
G59472 NA non-coding downstream 219328 13799998 ~ 13819996 (-)
G59473 NA non-coding downstream 251911 13700592 ~ 13787413 (-)
G59552 NA non-coding upstream 35731 14075624 ~ 14075833 (-)
G59602 NA non-coding upstream 124999 14164892 ~ 14214853 (-)
G59610 NA non-coding upstream 136110 14176003 ~ 14176444 (-)
G59626 NA non-coding upstream 148492 14188385 ~ 14189163 (-)
G59636 NA non-coding upstream 160018 14199911 ~ 14201000 (-)
G59490 NA other downstream 1451 14033564 ~ 14037873 (-)
G59097 NA other downstream 1749806 12288217 ~ 12289518 (-)
CI01000009_08858198_08860555 NA other downstream 5178761 8856310 ~ 8860563 (-)
G55814 NA other downstream 5611312 8425821 ~ 8428012 (-)
G59811 NA other upstream 822504 14862397 ~ 14887464 (-)
G59941 NA other upstream 1092211 15132104 ~ 15132503 (-)
CI01000009_15318811_15390382 TNS1 other upstream 1336367 15318811 ~ 15390382 (-)
CI01000009_15654061_15662554 ARPC2 other upstream 1606882 15653760 ~ 15663026 (-)

Expression


Co-expression Network