G58489


Basic Information

Item Value
gene id G58489
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 14125320 ~ 14156231 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU66619
GTCAATTCAATGCTGGATTTGCACAAAAGATTAACATGACGGCACATGCTAGTCGATGAGTTGAATCAACTCCACAGCAACTACATAAATTTATCCACTAGCCATTCAGAAACGTCCAGTTTCATTCTAAAAGTTGTAACATCTTCCTGAGTCTCTCCATCAGTGTCCGACTCCGGTTTGAGCAATGTAAGGCTGAACACCGTTACTGACAATCCTCATTTTGGCTGCGTGAGATTCTCCAGCTTTGTTGTTGTTGAGCAACCGAAGACGAGCTGTTAAAGGGAAGGGGGGCTGGGAGCAGCAGCTCATTTGCATTTAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU66619 True 320 lncRNA 0.44 2 14125320 14156231

Neighbor

gene id symbol gene type direction distance location
CI01000009_14039505_14043545 RETSATL coding upstream 81711 14039209 ~ 14043609 (+)
CI01000009_14033666_14036472 RETSATL coding upstream 88848 14033559 ~ 14036472 (+)
CI01000009_14007631_14010487 NA coding upstream 114627 14007087 ~ 14010693 (+)
CI01000009_13942733_13946356 FRZB coding upstream 178915 13942521 ~ 13946405 (+)
CI01000009_13884165_13939556 NCKAP1 coding upstream 185632 13883847 ~ 13939688 (+)
CI01000009_14170062_14192930 NA coding downstream 12990 14169221 ~ 14193332 (+)
CI01000009_14242224_14243004 NA coding downstream 85886 14242117 ~ 14243724 (+)
CI01000009_14264935_14273006 NA coding downstream 107192 14263423 ~ 14277555 (+)
CI01000009_14296451_14314340 ADARB1A, ADARB1B, ADARB1 coding downstream 140220 14296451 ~ 14314349 (+)
CI01000009_14348389_14374515 TRAF3IP1 coding downstream 192158 14348389 ~ 14375683 (+)
G58467 NA non-coding upstream 27617 14097491 ~ 14097703 (+)
G58421 NA non-coding upstream 73916 14050977 ~ 14051404 (+)
G58384 NA non-coding upstream 106847 14011905 ~ 14018473 (+)
G58388 NA non-coding upstream 121238 13996825 ~ 14004082 (+)
G58389 NA non-coding upstream 146716 13975388 ~ 13978604 (+)
G58452 NA non-coding downstream 42407 14198638 ~ 14201846 (+)
G58456 NA non-coding downstream 148709 14304940 ~ 14399351 (+)
G58447 NA non-coding downstream 237583 14393814 ~ 14402390 (+)
G58454 NA non-coding downstream 246418 14402649 ~ 14403582 (+)
G58382 NA other upstream 85419 14039757 ~ 14039901 (+)
G58028 NA other upstream 981712 13140378 ~ 13143608 (+)
G57701 NA other upstream 1102182 13006643 ~ 13023138 (+)
G57691 NA other upstream 1206855 12906444 ~ 12918465 (+)
G57682 NA other upstream 1232981 12825469 ~ 12892339 (+)
G58455 NA other downstream 90464 14246695 ~ 14258526 (+)
G58558 NA other downstream 340705 14496936 ~ 14501514 (+)
G58649 NA other downstream 493493 14649724 ~ 14652022 (+)
G58711 NA other downstream 610428 14766659 ~ 14773773 (+)
CI01000009_14857765_14859526 NA other downstream 662988 14857713 ~ 14859636 (+)

Expression


Co-expression Network