G59821


Basic Information

Item Value
gene id G59821
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 14976689 ~ 14977258 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU68108
ACGCATGTATATGTGAGCGAGCGCCTTTATCATGTCACATCCATGTTGCCTTCTGACGCGTTTTGTCTTGAATCTGCTGGAAAGCCGCTGAGCTTCGTGCACGAATCTGACGCTAGACCAGCCACAGAGTGCACGGAAGATCTCAGAGGAGCATATCTTCGATTTTGCATGGATTTGTGTTTTGCTCTGCGCTCTTGGCATCACTGCGTAAAAGACTGATCCTATTGCCGAGGGGGGAAAAAAGGCGCTGGCGCTGAGCCACGATCTGGCAAGTGCGCCTCCCTTCACCGCTGTTTGGCTTATTCATAGTTAGGGGTTTGGGTTTGGCTGTTTTTAAAAAGGCAAGCACTGCTGTGAAGTTGATCAGTCTGCTCAGAAAACTTCCAGAGGGGAAAGTGTTTTGGAATCGGAAAGTCCAGAATTTCAGTGCGCAACCAATTGCGCACAAACTGGACTATTGGAGAATACCCAAGTGATTCATTTATTTTATATGTATTTATATGAAAATCCACCGGATTCTTCTTTATCATCTTTTAGAGAAACTATTTTTTTTATCTTCTTATTTTTAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU68108 True 570 lncRNA 0.44 1 14976689 14977258

Neighbor

gene id symbol gene type direction distance location
CI01000009_14974529_14974816 NA coding downstream 1269 14974042 ~ 14975420 (-)
CI01000009_14961220_14973307 NA coding downstream 3284 14960980 ~ 14973405 (-)
CI01000009_14905408_14907785 NA coding downstream 68612 14904489 ~ 14908077 (-)
CI01000009_14776978_14779978 CX43.4 coding downstream 194736 14776859 ~ 14781953 (-)
CI01000009_14763341_14773678 NA coding downstream 203008 14763212 ~ 14773681 (-)
CI01000009_15229965_15235247 NA coding upstream 252399 15229657 ~ 15235528 (-)
CI01000009_15301177_15304489 NA coding upstream 323839 15301097 ~ 15304500 (-)
CI01000009_15318811_15390382 TNS1 coding upstream 341553 15318811 ~ 15390382 (-)
CI01000009_15483720_15484321 NA coding upstream 506451 15483709 ~ 15484321 (-)
CI01000009_15504401_15585060 NA coding upstream 527088 15503406 ~ 15585829 (-)
G59818 NA non-coding downstream 85476 14889076 ~ 14891213 (-)
G59794 NA non-coding downstream 162405 14814079 ~ 14814284 (-)
G59768 NA non-coding downstream 240408 14736017 ~ 14736281 (-)
G59754 NA non-coding downstream 260357 14716118 ~ 14716332 (-)
G59590 NA non-coding downstream 265496 14614098 ~ 14711193 (-)
G59898 NA non-coding upstream 113696 15090954 ~ 15091746 (-)
G59899 NA non-coding upstream 115216 15092474 ~ 15092737 (-)
G59913 NA non-coding upstream 125345 15102603 ~ 15102820 (-)
G59927 NA non-coding upstream 136501 15113759 ~ 15113970 (-)
G59937 NA non-coding upstream 151577 15128835 ~ 15129131 (-)
G59811 NA other downstream 89225 14862397 ~ 14887464 (-)
G59490 NA other downstream 938816 14033564 ~ 14037873 (-)
CI01000009_13975122_13976026 NA other downstream 998075 13975099 ~ 13978614 (-)
G59097 NA other downstream 2687171 12288217 ~ 12289518 (-)
CI01000009_08858198_08860555 NA other downstream 6116126 8856310 ~ 8860563 (-)
G59941 NA other upstream 154846 15132104 ~ 15132503 (-)
CI01000009_15654061_15662554 ARPC2 other upstream 669517 15653760 ~ 15663026 (-)

Expression


Co-expression Network