G60426



Basic Information


Item Value
gene id G60426
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 15288178 ~ 15288394 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU68779
TAAGAATTGCTTGTATTGATGTCTTGAAGATGTATTCATGAGTGAACTGCATGAAATGCAGGGTTCATTCAAAGGGCCTCGGAGTGTTTATTAATCCACATCTGGGCTTGTCATTAAGGCAGCATCAGAATAACAAGGTTAGCGAAAGGGAACAGTACATCAATGATAAGTACATCAAAGATAACTATACACAGCAGTGCGTTAGTGCAAGTTTTTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU68779 True 217 lncRNA 0.38 1 15288178 15288394
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000009_15229965_15235247 NA coding downstream 52650 15229657 ~ 15235528 (-)
CI01000009_14974529_14974816 NA coding downstream 312758 14974042 ~ 14975420 (-)
CI01000009_14961220_14973307 NA coding downstream 314773 14960980 ~ 14973405 (-)
CI01000009_14905408_14907785 NA coding downstream 380101 14904489 ~ 14908077 (-)
CI01000009_14776978_14779978 CX43.4 coding downstream 506225 14776859 ~ 14781953 (-)
CI01000009_15301177_15304489 NA coding upstream 12703 15301097 ~ 15304500 (-)
CI01000009_15318811_15390382 TNS1 coding upstream 30417 15318811 ~ 15390382 (-)
CI01000009_15483720_15484321 NA coding upstream 195315 15483709 ~ 15484321 (-)
CI01000009_15504401_15585060 NA coding upstream 215952 15503406 ~ 15585829 (-)
CI01000009_15654061_15662554 ARPC2 coding upstream 365366 15653760 ~ 15663026 (-)
G60422 NA non-coding downstream 3198 15284744 ~ 15284980 (-)
G60418 NA non-coding downstream 13066 15274789 ~ 15275112 (-)
G60384 NA non-coding downstream 70898 15217079 ~ 15217280 (-)
G59996 NA non-coding downstream 102694 15185264 ~ 15185484 (-)
G59974 NA non-coding downstream 124693 15163280 ~ 15163485 (-)
G60430 NA non-coding upstream 4053 15292447 ~ 15292685 (-)
G60370 NA non-coding upstream 23137 15311531 ~ 15320285 (-)
G60437 NA non-coding upstream 259767 15548161 ~ 15548460 (-)
G60439 NA non-coding upstream 261188 15549582 ~ 15549879 (-)
G59941 NA other downstream 155675 15132104 ~ 15132503 (-)
G59811 NA other downstream 400714 14862397 ~ 14887464 (-)
G59490 NA other downstream 1250305 14033564 ~ 14037873 (-)
CI01000009_13975122_13976026 NA other downstream 1309564 13975099 ~ 13978614 (-)
G59097 NA other downstream 2998660 12288217 ~ 12289518 (-)

Expression


G60426 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G60426 Expression in each Bioproject

Bar chart with 8 bars.
G60426 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network