G60430



Basic Information


Item Value
gene id G60430
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 15292447 ~ 15292685 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU68783
CCGGATCCGACTACGGTAAACCTAGGGATAAACAGAGAGACAGATATTAGACCTAATTTATGCAGCCTAACAATCCTTCAACAGATTTTAAAATAATCCTGAACAACATGTACAGTATCATGGTTTCCACAAAAATATTAAGCAGCACAACTGTTTTCAACATTAAGAAAAGTTTCTAGAATGATTTCTGAAGGATCATGTGACACTGAAGACAGGAGTAATGGCTACTGAAAATGCAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU68783 True 239 lncRNA 0.36 1 15292447 15292685

Neighbor


gene id symbol gene type direction distance location
CI01000009_15229965_15235247 NA coding downstream 56919 15229657 ~ 15235528 (-)
CI01000009_14974529_14974816 NA coding downstream 317027 14974042 ~ 14975420 (-)
CI01000009_14961220_14973307 NA coding downstream 319042 14960980 ~ 14973405 (-)
CI01000009_14905408_14907785 NA coding downstream 384370 14904489 ~ 14908077 (-)
CI01000009_14776978_14779978 CX43.4 coding downstream 510494 14776859 ~ 14781953 (-)
CI01000009_15301177_15304489 NA coding upstream 8412 15301097 ~ 15304500 (-)
CI01000009_15318811_15390382 TNS1 coding upstream 26126 15318811 ~ 15390382 (-)
CI01000009_15483720_15484321 NA coding upstream 191024 15483709 ~ 15484321 (-)
CI01000009_15504401_15585060 NA coding upstream 211661 15503406 ~ 15585829 (-)
CI01000009_15654061_15662554 ARPC2 coding upstream 361075 15653760 ~ 15663026 (-)
G60426 NA non-coding downstream 4053 15288178 ~ 15288394 (-)
G60422 NA non-coding downstream 7467 15284744 ~ 15284980 (-)
G60418 NA non-coding downstream 17335 15274789 ~ 15275112 (-)
G60384 NA non-coding downstream 75167 15217079 ~ 15217280 (-)
G59996 NA non-coding downstream 106963 15185264 ~ 15185484 (-)
G60370 NA non-coding upstream 18846 15311531 ~ 15320285 (-)
G60437 NA non-coding upstream 255476 15548161 ~ 15548460 (-)
G60439 NA non-coding upstream 256897 15549582 ~ 15549879 (-)
G60442 NA non-coding upstream 296972 15589657 ~ 15649377 (-)
G59941 NA other downstream 159944 15132104 ~ 15132503 (-)
G59811 NA other downstream 404983 14862397 ~ 14887464 (-)
G59490 NA other downstream 1254574 14033564 ~ 14037873 (-)
CI01000009_13975122_13976026 NA other downstream 1313833 13975099 ~ 13978614 (-)
G59097 NA other downstream 3002929 12288217 ~ 12289518 (-)

Expression



Co-expression Network