G60213


Basic Information

Item Value
gene id G60213
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 15662473 ~ 15662695 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU68530
CCTCTTACCCGTTGCTCGCGCTGTCGAATTTGAGGCTGAGAGTCTCCTCTATGATCCGATTGTTGATTTCCAACAAAATCATGATGATTTAAATGAATGTTTAATGGCTATGTGGAATTAAAAATATAAGAGCAAATGTTGCTTTTCTACAATCCTACTACAATCGTTTTGGTTTTCCTGCTCCTAGACTTCCGGCCGCTTCCGCATTGACTCGAAAGACCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU68530 True 223 lncRNA 0.42 1 15662473 15662695

Neighbor

gene id symbol gene type direction distance location
CI01000009_15637754_15643935 NA coding upstream 18538 15637650 ~ 15643935 (+)
CI01000009_15625341_15626360 GPBAR1 coding upstream 36070 15625159 ~ 15626403 (+)
CI01000009_15610515_15613753 NA coding upstream 48720 15610032 ~ 15613753 (+)
CI01000009_15415868_15427139 NA coding upstream 235275 15413174 ~ 15427198 (+)
CI01000009_14976078_14977321 NA coding upstream 685049 14975771 ~ 14977424 (+)
CI01000009_15667251_15668333 NA coding downstream 4556 15667251 ~ 15669450 (+)
CI01000009_15680573_15681601 NA coding downstream 17878 15680573 ~ 15681976 (+)
CI01000009_15708273_15712002 METTL5 coding downstream 43765 15706460 ~ 15712005 (+)
CI01000009_15738136_15745816 CCDC173 coding downstream 75377 15738072 ~ 15745866 (+)
CI01000009_15770057_15782295 FASTKD1 coding downstream 107362 15770057 ~ 15783049 (+)
G60222 NA non-coding upstream 105572 15556519 ~ 15556901 (+)
G60221 NA non-coding upstream 106640 15555606 ~ 15555833 (+)
G60220 NA non-coding upstream 107062 15555133 ~ 15555411 (+)
G60219 NA non-coding upstream 107777 15554354 ~ 15554696 (+)
G60218 NA non-coding upstream 108638 15553627 ~ 15553835 (+)
G60280 NA non-coding downstream 14787 15677482 ~ 15694591 (+)
G60286 NA non-coding downstream 35084 15697779 ~ 15698147 (+)
G60293 NA non-coding downstream 85825 15748520 ~ 15749113 (+)
G60303 NA non-coding downstream 136986 15799681 ~ 15801256 (+)
G60028 NA other upstream 286304 15352047 ~ 15376169 (+)
CI01000009_14925314_14952223 NA other upstream 706678 14924621 ~ 14952571 (+)
CI01000009_14857765_14859526 NA other upstream 803829 14857713 ~ 14859636 (+)
G58711 NA other upstream 888700 14766659 ~ 14773773 (+)
G58649 NA other upstream 1010451 14649724 ~ 14652022 (+)

Expression


Co-expression Network