G60479


Basic Information

Item Value
gene id G60479
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 15802887 ~ 15803791 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU68840
TATCAAGCAGTAAAAGCGCCTTTTCTTGAGCCCAAAACCAATCGTCTGTGGATGAGAGTATGAAATAAGGACTGGTGGGTTATTATCCTGCACCACTTCACAGACGATGAGTGGAAAGAGAATTTCAAAATGACAGGAAACTCACTTAAGAAATTAAGGTTTTTGAGAAAAATCCTGGAATGTTTTCCTCAAAAACCTTAAATTCTTTTCTATTGAGGAAAGAAAGACATAAACATCTTGGATGACACGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU68840 True 251 lncRNA 0.37 2 15802887 15803791

Neighbor

gene id symbol gene type direction distance location
CI01000009_15791178_15798430 BBS5.L, BBS5 coding downstream 4457 15790849 ~ 15798430 (-)
CI01000009_15784118_15789896 KLHL41, KLHL41A coding downstream 12991 15784080 ~ 15789896 (-)
CI01000009_15726357_15736168 PHGDH coding downstream 66719 15726145 ~ 15736168 (-)
CI01000009_15716557_15721525 KLHL23 coding downstream 81291 15716477 ~ 15721596 (-)
CI01000009_15693066_15694538 UGT5B4, UGT5B6 coding downstream 108258 15692994 ~ 15694629 (-)
CI01000009_15847186_15853675 CCDC89 coding upstream 43127 15846918 ~ 15853675 (-)
CI01000009_15975897_15978506 RDH1 coding upstream 171939 15975730 ~ 15978506 (-)
CI01000009_15981692_15985027 DHRS9 coding upstream 177894 15981685 ~ 15985027 (-)
G60367 NA non-coding downstream 3928 15781299 ~ 15798959 (-)
G60472 NA non-coding downstream 51893 15750698 ~ 15750994 (-)
G60376 NA non-coding downstream 56401 15745468 ~ 15746486 (-)
G60469 NA non-coding downstream 83726 15718562 ~ 15719161 (-)
G60468 NA non-coding downstream 90740 15708004 ~ 15712147 (-)
CI01000009_15654061_15662554 ARPC2 other downstream 146918 15653760 ~ 15663026 (-)
CI01000009_15318811_15390382 TNS1 other downstream 359840 15318811 ~ 15390382 (-)
G59941 NA other downstream 670384 15132104 ~ 15132503 (-)
G59811 NA other downstream 915423 14862397 ~ 14887464 (-)
G59490 NA other downstream 1765014 14033564 ~ 14037873 (-)

Expression


Co-expression Network