Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

ornamental fish

G60910

Basic Information

Item	Value
gene id	G60910
gene name	NA
gene type	non-coding
species	mexican tetra (Astyanax mexicanus)
category of species	ornamental fish

Chromosome Information

Item	Value
chromosome id	NC_035903.1
NCBI id	CM008306.1
chromosome length	40813162
location	455836 ~ 470689 (+)
genome version	Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU82130
taatataatcaagagaaagattgatgatcacaagccatcaaaccaaactgaactgcttgaatttttgcaccaggagtaaaggcataaagttgtcctaaagcagtgtgtaagactggtggaggagaacatgtcaagatgtgtttaaaaaccagggttattccaccaaatattgatttctgaactcttaaaactttatgaatatgaact

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU82130	True	207	lncRNA	0.35	2	455836	470689

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
LOC103031583	NA	coding	upstream	260992	192192 ~ 194844 (+)
braf	braf,LOC107725591	coding	upstream	276826	148669 ~ 179010 (+)
LOC111192919	NA	coding	downstream	88337	559026 ~ 565310 (+)
LOC103022716	NA	coding	downstream	99532	570221 ~ 574501 (+)
LOC107197032	NA	coding	downstream	116004	586693 ~ 590105 (+)
LOC103021355	LOC103021355,LOC108426405,LOC108279735,LOC107757248,LOC107694301,LOC100694258,LOC107590616	coding	downstream	143424	614113 ~ 621742 (+)
syt10	syt10,LOC107744086,LOC107656242,LOC107565666,LOC107592193,LOC107658793	coding	downstream	279192	749881 ~ 780797 (+)
G60903	NA	non-coding	upstream	178514	277010 ~ 277322 (+)
G60983	NA	non-coding	downstream	146085	616774 ~ 623435 (+)
G60996	NA	non-coding	downstream	270002	740691 ~ 740898 (+)
G61011	NA	non-coding	downstream	329960	800649 ~ 800870 (+)
G61016	NA	non-coding	downstream	363298	833987 ~ 835273 (+)
G61023	NA	non-coding	downstream	370906	841595 ~ 949084 (+)
mrps33	mrps33,LOC106591474,LOC107694294,LOC107725593	other	upstream	309062	144189 ~ 146774 (+)
LOC103023024	cry1,LOC103023024,LOC108426403,LOC108279922,LOC105900698,LOC107560722	other	downstream	68829	539518 ~ 558580 (+)
LOC103045537	NA	other	downstream	128970	599659 ~ 625009 (+)
G61014	NA	other	downstream	335876	806565 ~ 1049056 (+)
G61013	LOC108444125,LOC108444119,LOC108412201,LOC108262118	other	downstream	382837	853526 ~ 1043316 (+)
LOC103024246	tspan11,LOC108279944,LOC107593980,LOC106576552,LOC107720401,LOC107560736,LOC107694254	other	downstream	974946	1445635 ~ 1481418 (+)

Expression

Co-expression Network