G63268


Basic Information

Item Value
gene id G63268
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035903.1
NCBI id CM008306.1
chromosome length 40813162
location 11701418 ~ 11701706 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU85379
attacagaaaatagataaataacattaataccaccttaataccattaacagagctctttttatatttgtttttaagctcacctcgatttactcagctttactcaacaagacttgagcatttcatcaagagaacttggacaaacagcttctgtaacccagaaaaatacaaggcttgaacacgaggagcacactaccccacagaaacaatgccatctgcccgcatctggttatgattcatccaaaatacatgtttagaaaggcaatataggcatctactactgttataggc

Function

GO:

id name namespace
GO:0030162 regulation of proteolysis biological_process
GO:0006508 proteolysis biological_process
GO:0008236 serine-type peptidase activity molecular_function
GO:0017171 serine hydrolase activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko04972 Pancreatic secretion
ko05322 Systemic lupus erythematosus
ko05020 Prion disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU85379 True 289 lncRNA 0.37 1 11701418 11701706

Neighbor

gene id symbol gene type direction distance location
brd1 brd1 coding upstream 1236700 10440014 ~ 10464718 (+)
alg12 alg12 coding upstream 1280609 10409021 ~ 10420809 (+)
pim3 pim3 coding upstream 1384997 10310441 ~ 10316421 (+)
il17rel NA coding upstream 1630536 10042203 ~ 10070882 (+)
usp15 usp15 coding upstream 1734127 9929508 ~ 9967291 (+)
LOC103028484 srr,LOC108427077,LOC108279919,LOC106575990 coding downstream 278665 11980371 ~ 11986784 (+)
alg10 LOC108427075 coding downstream 288894 11990600 ~ 11997857 (+)
c7h12orf40 NA coding downstream 659478 12361184 ~ 12373369 (+)
LOC103032294 NA coding downstream 809182 12510888 ~ 12556587 (+)
LOC103032798 NA coding downstream 856954 12558660 ~ 12595497 (+)
G63260 NA non-coding upstream 65872 11630642 ~ 11635546 (+)
G63254 NA non-coding upstream 1070945 10630128 ~ 10630473 (+)
G63246 NA non-coding upstream 1135625 10564696 ~ 10565793 (+)
G63244 NA non-coding upstream 1151796 10549347 ~ 10549622 (+)
LOC111192872 NA non-coding upstream 1347678 10346960 ~ 10353740 (+)
G63269 NA non-coding downstream 16316 11718022 ~ 11718542 (+)
G63285 NA non-coding downstream 109450 11811156 ~ 11811590 (+)
G63303 NA non-coding downstream 255179 11956885 ~ 11975553 (+)
G63328 NA non-coding downstream 285292 11986998 ~ 11990396 (+)
G63329 NA non-coding downstream 305579 12007285 ~ 12007519 (+)
G63051 NA other upstream 2051331 9646579 ~ 9650087 (+)
LOC111192948 NA other upstream 2260854 9431499 ~ 9440564 (+)
LOC103041471 slc37a3,LOC106609230,LOC106576065,LOC107719875,LOC107758206,LOC107601005,LOC107562143 other upstream 3161295 8526218 ~ 8540123 (+)
rab19 rab19,LOC108425368,LOC106523538 other upstream 3286379 8401840 ~ 8415039 (+)
G62455 gpr85,LOC106576049,LOC107580073 other upstream 4845656 6851230 ~ 6855762 (+)
G63432 NA other downstream 766344 12468050 ~ 12468902 (+)
LOC111192955 NA other downstream 1454520 13156226 ~ 13161367 (+)
gata3 gata3,LOC107555822 other downstream 2465523 14167229 ~ 14242234 (+)
G64015 NA other downstream 3043029 14744735 ~ 14745082 (+)
arid2 arid2,LOC107707985,LOC107555896 other downstream 4693620 16395326 ~ 16426623 (+)

Expression


Co-expression Network