G63749 (vezt,LOC107567659,LOC107667718)


Basic Information

Item Value
gene id G63749
gene name vezt,LOC107567659,LOC107667718
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035903.1
NCBI id CM008306.1
chromosome length 40813162
location 13486399 ~ 13487618 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU85999
CATTTGTTAGCTCCTGCGCCTGTTCGTCAGAAAGATGCTCCGCCCCCAGACCGAGACCCAGTTCTCTGATTGGCACGGTAGAGACGTAGTTGGTGACATTGTCGATCTCCGAGTTCAGAGGAAAAGATTTAAGCATAATGCAGGTGGCGAGGCGCGAGGCTCTGAAGGCGCAGCGTAGACTCTGGTAGGCTGCTTTCCTCAGGCCAATCAGCTGCTGGCTGCGCAGTTGCCCCGCCCTGTTGAAGGGACAGGCCGCACTCACCCTGT

Function

symbol description
vezt Predicted to enable myosin binding activity. Predicted to be involved in cell-cell adhesion. Predicted to be located in adherens junction; membrane; and nucleus. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Orthologous to human VEZT (vezatin, adherens junctions transmembrane protein).

NR:

description
PREDICTED: vezatin isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU85999 True 267 lncRNA 0.57 2 13486399 13487618

Neighbor

gene id symbol gene type direction distance location
usp44 usp44,LOC107755158,LOC107748469,LOC107667716,LOC107597009 coding upstream 40727 13433569 ~ 13445672 (+)
LOC103026035 NA coding upstream 90136 13386538 ~ 13396263 (+)
LOC103036201 NA coding upstream 104484 13369680 ~ 13381915 (+)
st8sia1 st8sia1,LOC107755164,LOC107748471,LOC107567669,LOC108279455,LOC108279490 coding upstream 183287 13271177 ~ 13303112 (+)
LOC103034836 NA coding upstream 243657 13210222 ~ 13242742 (+)
fgd6 NA coding downstream 19760 13507378 ~ 13539050 (+)
LOC103030426 nr2c1,LOC107689225,LOC107755159 coding downstream 57334 13544952 ~ 13557590 (+)
ndufa12 ndufa12,LOC107667714,LOC107755161 coding downstream 73818 13561436 ~ 13565100 (+)
tmcc3 tmcc3 coding downstream 103994 13591612 ~ 13633235 (+)
rbm17 rbm17,LOC107748463,LOC107755150,LOC107663450 coding downstream 270710 13758328 ~ 13773588 (+)
G63743 NA non-coding upstream 10979 13472434 ~ 13475420 (+)
G63709 NA non-coding upstream 85089 13397632 ~ 13401310 (+)
G63514 NA non-coding upstream 160891 13325300 ~ 13325508 (+)
G63510 NA non-coding upstream 175228 13257901 ~ 13311171 (+)
G63493 NA non-coding upstream 287564 13173393 ~ 13198835 (+)
G63756 NA non-coding downstream 53543 13541161 ~ 13542001 (+)
G63755 NA non-coding downstream 54995 13542613 ~ 13543511 (+)
G63791 NA non-coding downstream 86102 13573720 ~ 13677259 (+)
G63813 NA non-coding downstream 224291 13711909 ~ 13713440 (+)
G63827 NA non-coding downstream 267247 13754865 ~ 13755370 (+)
LOC111192955 NA other upstream 325032 13156226 ~ 13161367 (+)
G63432 NA other upstream 1017497 12468050 ~ 12468902 (+)
G63051 NA other upstream 3836312 9646579 ~ 9650087 (+)
LOC111192948 NA other upstream 4045835 9431499 ~ 9440564 (+)
LOC103041471 slc37a3,LOC106609230,LOC106576065,LOC107719875,LOC107758206,LOC107601005,LOC107562143 other upstream 4946276 8526218 ~ 8540123 (+)
gata3 gata3,LOC107555822 other downstream 679611 14167229 ~ 14242234 (+)
G64015 NA other downstream 1257117 14744735 ~ 14745082 (+)
arid2 arid2,LOC107707985,LOC107555896 other downstream 2907708 16395326 ~ 16426623 (+)
G64289 NA other downstream 2951602 16439220 ~ 16442449 (+)
G64431 NA other downstream 3265425 16753043 ~ 16753560 (+)

Expression


Co-expression Network